Mutants (Isolated)

tm1724

Allele Nametm1724
Sequence NameT28F3.6
CGC Nameifta-2
Worm BaseAllele Name tm1724
CGC Name ifta-2
Sequence T28F3.6
Phenotypehomozygous viable. Dr. P. Sengupta: normal dye filling.
Mutation site20979/20980-CACTCCTCGATCAGAATCTGTCATGATTGTCTCTTGCTCCTG-21763/21764 (784 bp deletion + 42 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(20593..20773, 20825..21028, 21205..21328, 21409..21544, 21656..21769))
Map position16.45
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGGAGGCTCTTGATTGGGT,ExtFwd:AACCTTCACTATCGGAGGCT,IntRev:GTAGCCGGCGAGTTCACTGT,ExtRev:CTGCGTACCGGGAACTTTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schafer JC, Winkelbauer ME, Williams CL, Haycraft CJ, Desmond RA, Yoder BK.
IFTA-2 is a conserved cilia protein involved in pathways regulating longevity and dauer formation in Caenorhabditis elegans.
J. Cell. Sci. 2006 119(Pt 19) 4088-100 
[ PubMed ID = 16968739 ] [ RRC reference ]

Vermezovic J, Stergiou L, Hengartner MO, d'Adda di Fagagna F.
Differential regulation of DNA damage response activation between somatic and germline cells in Caenorhabditis elegans.
Cell Death Differ. 2012 19(11) 1847-55 
[ PubMed ID = 22705849 ] [ RRC reference ]