Mutants (Isolated)

tm1723

Allele Nametm1723
Sequence NameZK1251.3
CGC NameZK1251.3
Worm BaseAllele Name tm1723
CGC Name ZK1251.3
Sequence ZK1251.3
Phenotypehomozygous viable
Mutation site12392/12393-CG-13133/13134 (741 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurejoin(12434..12889, 12938..13243)
Map position4.36
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGAACCGACTAGGCTGCGA,ExtFwd:GCCCTCTTGTGACTAAAGTC,IntRev:GTTGAGCAGCTCATTAACTC,ExtRev:CCTTGCCTGAGTCACCTAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2007 104(48) 19046-50 
[ PubMed ID = 18025456 ] [ RRC reference ]