Mutants (Isolated)

tm1714

Allele Nametm1714
Sequence NameY47D3A.16
CGC Namersks-1
Worm BaseAllele Name tm1714
CGC Name rsks-1
Sequence Y47D3A.16
Phenotypehomozygous viable. Dr. S. Tuck, Dr. K. Ashrafi, Dr. G. Ruvkun: reduced body size.
Mutation site112117/112118-TTT-112601/112602 (484 bp deletion + 3 bp insertion)
ChromosomeIII
Putative gene structurejoin(109161..109225, 110205..110268, 110701..110859, 111868..112904, 113946..114269, 114942..115035)
Map position7.72
Balancer
Map position of balancer
Sequence of primersIntRev:GTGCCACCGAAATTCCACCA,ExtRev:GCAGCACCAGCTCTCGACAT,IntFwd:TGCCAGTGCAATTAATCCAC,ExtFwd:CTCATCGTATATGGAGGATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Seo K, Choi E, Lee D, Jeong DE, Jang SK, Lee SJ.
Heat shock factor 1 mediates the longevity conferred by inhibition of TOR and insulin/IGF-1 signaling pathways in C. elegans.
Aging Cell 2013 12(6) 1073-81 
[ PubMed ID = 23879233 ] [ RRC reference ]

Chen D, Li PW, Goldstein BA, Cai W, Thomas EL, Chen F, Hubbard AE, Melov S, Kapahi P.
Germline signaling mediates the synergistically prolonged longevity produced by double mutations in daf-2 and rsks-1 in C. elegans.
Cell Rep 2013 5(6) 1600-10 
[ PubMed ID = 24332851 ] [ RRC reference ]

Son HG, Seo K, Seo M, Park S, Ham S, An SWA, Choi ES, Lee Y, Baek H, Kim E, Ryu Y, Ha CM, Hsu AL, Roh TY, Jang SK, Lee SV.
Prefoldin 6 mediates longevity response from heat shock factor 1 to FOXO in C. elegans.
Genes Dev 2018 32(23-24) 1562-1575 
[ PubMed ID = 30478249 ] [ RRC reference ]

Nukazuka A, Tamaki S, Matsumoto K, Oda Y, Fujisawa H, Takagi S.
A shift of the TOR adaptor from Rictor towards Raptor by semaphorin in C. elegans.
Nat Commun 2011 2 484 
[ PubMed ID = 21952218 ] [ RRC reference ]

Hubert T, Wu Z, Chisholm AD, Jin Y.
S6 kinase inhibits intrinsic axon regeneration capacity via AMP kinase in Caenorhabditis elegans.
J Neurosci 2014 34(3) 758-63 
[ PubMed ID = 24431434 ] [ RRC reference ]