Mutants (Isolated)

tm1711

Allele Nametm1711
Sequence NameF42G9.7
CGC Namesnt-2
Worm BaseAllele Name tm1711
CGC Name snt-2
Sequence F42G9.7
Phenotypehomozygous viable. Dr. G. Hermann: wild-type gut granules.
Mutation site31884/31885-32746/32747 (862 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30884..31000, 31505..31606, 31653..31786, 32393..32513, 33497..33667, 33710..33838))
Map position-26.01
Balancer
Map position of balancer
Sequence of primersIntRev:TCTAGTGGCTGGCCTCACTT,IntFwd:GCACGCGTGGGTGATCTGAA,ExtRev:GACCCCAAATCTCATAGTCA,ExtFwd:GTCATCATTTCAGCCCACTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim S, Sieburth D.
Sphingosine Kinase Regulates Neuropeptide Secretion During the Oxidative Stress-Response Through Intertissue Signaling.
J. Neurosci. 2018 38(38) 8160-8176 
[ PubMed ID = 30082417 ] [ RRC reference ]

Mullen GP, Grundahl KM, Gu M, Watanabe S, Hobson RJ, Crowell JA, McManus JR, Mathews EA, Jorgensen EM, Rand JB.
UNC-41/stonin functions with AP2 to recycle synaptic vesicles in Caenorhabditis elegans.
PLoS ONE 2012 7(7) e40095 
[ PubMed ID = 22808098 ] [ RRC reference ]

Kim S, Sieburth D.
A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans.
Genetics 2019 211(4) 1283-1295 
[ PubMed ID = 30782598 ] [ RRC reference ]

Wang H, Girskis K, Janssen T, Chan JP, Dasgupta K, Knowles JA, Schoofs L, Sieburth D.
Neuropeptide secreted from a pacemaker activates neurons to control a rhythmic behavior.
Curr. Biol. 2013 23(9) 746-54 
[ PubMed ID = 23583549 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]