Mutants (Isolated)

tm1698

Allele Nametm1698
Sequence NameC13C4.3
CGC Namenhr-136
Worm BaseAllele Name tm1698
CGC Name nhr-136
Sequence C13C4.3
Phenotypehomozygous viable
Mutation site5507/5508-6691/6692 (1184 bp deletion)
ChromosomeV
Putative gene structurejoin(5841..6018, 6086..6252, 6301..6408, 6450..6553, 6603..6833, 6881..7002, 7101..7369)
Map position3.66
Balancer
Map position of balancer
Sequence of primersIntRev:GGATAACGGATTCAGGTTGT,IntFwd:AGATGCGTTGATCGGTGCAG,ExtFwd:CAGACGCAGACGGTACGTAG,ExtRev:GCGGTTAAACTGATTGCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rodrigues AJ, Neves-Carvalho A, Teixeira-Castro A, Rokka A, Corthals G, Logarinho E, Maciel P.
Absence of ataxin-3 leads to enhanced stress response in C. elegans.
PLoS ONE 2011 6(4) e18512 
[ PubMed ID = 21526185 ] [ RRC reference ]

Rodrigues AJ, Coppola G, Santos C, Costa Mdo C, Ailion M, Sequeiros J, Geschwind DH, Maciel P.
Functional genomics and biochemical characterization of the C. elegans orthologue of the Machado-Joseph disease protein ataxin-3.
FASEB J. 2007 21(4) 1126-36 
[ PubMed ID = 17234717 ] [ RRC reference ]