Mutants (Isolated)

tm1689

Allele Nametm1689
Sequence NameF28F8.6
CGC Nameatx-3
Worm BaseAllele Name tm1689
CGC Name atx-3
Sequence F28F8.6
Phenotypehomozygous viable. Dr. P. Maciel: FASEB J. 21, 1126 (2007).
Mutation site28875/28876-GAAAAA-29535/29536 (660 bp deletion + 6 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(28399..28883, 29029..29183, 29234..29379, 29428..29595))
Map position8.39
Balancer
Map position of balancer
Sequence of primersIntFwd:GCACTAGCTTAAGCTCGAAT,ExtFwd:CTACTCCTCGTGGAGCACTA,ExtRev:GGAGACTTGAAGTCGCCGAA,IntRev:GCGGTGTCGTTATTTCGGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fardghassemi Y, Tauffenberger A, Gosselin S, Parker JA.
Rescue of ATXN3 neuronal toxicity in Caenorhabditiselegans by chemical modification of endoplasmic reticulum stress.
Dis Model Mech 2017 10(12) 1465-1480 
[ PubMed ID = 29061563 ] [ RRC reference ]

Rodrigues AJ, Coppola G, Santos C, Costa Mdo C, Ailion M, Sequeiros J, Geschwind DH, Maciel P.
Functional genomics and biochemical characterization of the C. elegans orthologue of the Machado-Joseph disease protein ataxin-3.
FASEB J. 2007 21(4) 1126-36 
[ PubMed ID = 17234717 ] [ RRC reference ]