Mutants (Isolated)

tm1688

Allele Name

tm1688

Sequence Name

T24B8.6

CGC Name

hlh-3

Worm Base

Allele Name

tm1688

CGC Name

hlh-3

Sequence

T24B8.6

Phenotype

homozygous viable

Mutation site

35589/35590-36831/36832 (1242 bp deletion)

Chromosome

Putative gene structure

join(35567..35662, 36199..36396, 36888..37205)

Map position

Balancer

Map position of balancer

Sequence of primers

IntRev:GGGGATATACGGGAGACTGT,ExtFwd:CAAGGGCTCAAGTGAGCGTG,IntFwd:GCCGGCAAAAAGCACTAGTC,ExtRev:GTAGCTTGGCGATGGAGTCT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Perez LM, Alfonso A.
The Conserved ASCL1/MASH-1 Ortholog HLH-3 Specifies Sex-Specific Ventral Cord Motor Neuron Fate in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 4201-4213
[ PubMed ID = 32973001 ] [ RRC reference ]

Masoudi N, Tavazoie S, Glenwinkel L, Ryu L, Kim K, Hobert O.
Unconventional function of an Achaete-Scute homolog as a terminal selector of nociceptive neuron identity.
PLoS Biol 2018 16(4) e2004979
[ PubMed ID = 29672507 ] [ RRC reference ]

Lloret-Fernández C, Maicas M, Mora-Martínez C, Artacho A, Jimeno-Martín Á, Chirivella L, Weinberg P, Flames N.
A transcription factor collective defines the HSN serotonergic neuron regulatory landscape.
Elife 2018 7
[ PubMed ID = 29553368 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672
[ PubMed ID = 28238659 ] [ RRC reference ]

Li Y, Zhao D, Horie T, Chen G, Bao H, Chen S, Liu W, Horie R, Liang T, Dong B, Feng Q, Tao Q, Liu X.
Conserved gene regulatory module specifies lateral neural borders across bilaterians.
Proc Natl Acad Sci U S A 2017 114(31) E6352-E6360
[ PubMed ID = 28716930 ] [ RRC reference ]

Sallee MD, Littleford HE, Greenwald I.
A bHLH Code for Sexually Dimorphic Form and Function of the C. elegans Somatic Gonad.
Curr Biol 2017 27(12) 1853-1860.e5
[ PubMed ID = 28602651 ] [ RRC reference ]

Murgan S, Kari W, Rothbächer U, Iché-Torres M, Mélénec P, Hobert O, Bertrand V.
Atypical Transcriptional Activation by TCF via a Zic Transcription Factor in C. elegans Neuronal Precursors.
Dev Cell 2015 33(6) 737-45
[ PubMed ID = 26073017 ] [ RRC reference ]

Doonan R, Hatzold J, Raut S, Conradt B, Alfonso A.
HLH-3 is a C. elegans Achaete/Scute protein required for differentiation of the hermaphrodite-specific motor neurons.
Mech Dev 2008 125(9-10) 883-93
[ PubMed ID = 18586090 ] [ RRC reference ]