Mutants (Isolated)

tm1683

Allele Nametm1683
Sequence NameY102A5A.1
CGC Namecand-1
Worm BaseAllele Name tm1683
CGC Name cand-1
Sequence Y102A5A.1
Phenotypehomozygous viable. Dr. E. Kipreos: viable with slow growth but a percentage arrest as embryos and larvae.
Mutation site3028/3029-3682/3683 (654 bp deletion)
ChromosomeV
Putative gene structurejoin(2265..2402, 2895..3005, 3540..3794, 4465..4978, 5796..6679, 7348..7524, 7941..8094, 8593..8684, 9399..10036, 10916..11230, Z81593.1:105..209, Z81593.1:983..1352, Z81593.1:2277..2348)
Map position11.19
Balancer
Map position of balancer
Sequence of primersExtFwd:GTGCTTATCATGTCGGGCAA,IntRev:GAGGCAAGATGTCCGATTCC,ExtRev:TCCGTTGATTACAGAGGCAA,IntFwd:CATGTCGGGCAACTGGTCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chaudhari SN, Kipreos ET.
The Energy Maintenance Theory of Aging: Maintaining Energy Metabolism to Allow Longevity.
Bioessays 2018 40(8) e1800005 
[ PubMed ID = 29901833 ] [ RRC reference ]

Dove KK, Kemp HA, Di Bona KR, Reiter KH, Milburn LJ, Camacho D, Fay DS, Miller DL, Klevit RE.
Two functionally distinct E2/E3 pairs coordinate sequential ubiquitination of a common substrate in Caenorhabditis elegans development.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(32) E6576-E6584 
[ PubMed ID = 28739890 ] [ RRC reference ]

Chaudhari SN, Kipreos ET.
Increased mitochondrial fusion allows the survival of older animals in diverse C. elegans longevity pathways.
Nat Commun 2017 8(1) 182 
[ PubMed ID = 28769038 ] [ RRC reference ]

Bosu DR, Feng H, Min K, Kim Y, Wallenfang MR, Kipreos ET.
C. elegans CAND-1 regulates cullin neddylation, cell proliferation and morphogenesis in specific tissues.
Dev. Biol. 2010 346(1) 113-26 
[ PubMed ID = 20659444 ] [ RRC reference ]

Alleva B, Clausen S, Koury E, Hefel A, Smolikove S.
CRL4 regulates recombination and synaptonemal complex aggregation in the Caenorhabditis elegans germline.
PLoS Genet. 2019 15(11) e1008486 
[ PubMed ID = 31738749 ] [ RRC reference ]