Home > Mutants (Isolated) > tm1683

Mutants (Isolated)

Allele Name		tm1683
Allele Type		Normal
Sequence Name		Y102A5A.1
Gene Name		cand-1
Worm Base	Allele Name	tm1683
	Gene Name	cand-1
	Sequence	Y102A5A.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. E. Kipreos: viable with slow growth but a percentage arrest as embryos and larvae.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3028/3029-3682/3683 (654 bp deletion)
Chromosome		V
Putative gene structure		join(2265..2402, 2895..3005, 3540..3794, 4465..4978, 5796..6679, 7348..7524, 7941..8094, 8593..8684, 9399..10036, 10916..11230, Z81593.1:105..209, Z81593.1:983..1352, Z81593.1:2277..2348)
Map position		11.19
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTGCTTATCATGTCGGGCAA,IntRev:GAGGCAAGATGTCCGATTCC,ExtRev:TCCGTTGATTACAGAGGCAA,IntFwd:CATGTCGGGCAACTGGTCGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Alleva B, Clausen S, Koury E, Hefel A, Smolikove S. CRL4 regulates recombination and synaptonemal complex aggregation in the Caenorhabditis elegans germline. PLoS Genet 2019 15(11) e1008486  [ PubMed ID = 31738749 ] [ RRC reference ] Dove KK, Kemp HA, Di Bona KR, Reiter KH, Milburn LJ, Camacho D, Fay DS, Miller DL, Klevit RE. Two functionally distinct E2/E3 pairs coordinate sequential ubiquitination of a common substrate in Caenorhabditis elegans development. Proc Natl Acad Sci U S A 2017 114(32) E6576-E6584  [ PubMed ID = 28739890 ] [ RRC reference ] Chaudhari SN, Kipreos ET. The Energy Maintenance Theory of Aging: Maintaining Energy Metabolism to Allow Longevity. Bioessays 2018 40(8) e1800005  [ PubMed ID = 29901833 ] [ RRC reference ] Chaudhari SN, Kipreos ET. Increased mitochondrial fusion allows the survival of older animals in diverse C. elegans longevity pathways. Nat Commun 2017 8(1) 182  [ PubMed ID = 28769038 ] [ RRC reference ] Bosu DR, Feng H, Min K, Kim Y, Wallenfang MR, Kipreos ET. C. elegans CAND-1 regulates cullin neddylation, cell proliferation and morphogenesis in specific tissues. Dev Biol 2010 346(1) 113-26  [ PubMed ID = 20659444 ] [ RRC reference ]