Mutants (Isolated)

tm1670

Allele Nametm1670
Sequence NameF57B10.6
CGC Namexpg-1
Worm BaseAllele Name tm1670
CGC Name xpg-1
Sequence F57B10.6
Phenotypehomozygous viable. Dr. W. Vermeulen: normal locomotion but UV sensitive. Dr. S. Boulton: not sensitive to ionizing radiation. not Him, does not genetically interact with him-9 or him-6. Dr.M. Hengartner: defective in UV induced apoptosis.
Mutation site10444/10445-11377/11378 (933 bp deletion)
ChromosomeI
Putative gene structurejoin(10316..10403, 10538..10803, 11239..11565, 11621..11704, 11962..12397, 12445..12918, 12969..13129, 13176..13307, 13394..13915)
Map position1.21
Balancer
Map position of balancer
Sequence of primersExtRev:TCTGGTCCAGTTACGTTGAT,IntFwd:ACGGAGATCAATTTGCATCC,IntRev:GAGTATCCACCTGTGGAGGT,ExtFwd:GGTTGGACAAATGGCGTTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet. 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]

Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ. 2011 18(5) 897-906 
[ PubMed ID = 21151025 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet. 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ. 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]