Mutants (Isolated)

tm1653

Allele Nametm1653
Sequence NameZK970.5
CGC Namegcy-4
Worm BaseAllele Name tm1653
CGC Name gcy-4
Sequence ZK970.5
Phenotypehomozygous viable. Dr. Y. Iino: fertile, normal locomotion, normal chemotaxis to KCl. Dr. O. Hobert: bromide/iodide chemotaxis defective.
Mutation site22629/22630-CTT-22916/22917 (287 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(18015..18448, 18499..18602, 18990..19060, 19117..19309, 19359..19677, 19736..20030, 20078..20740, 20797..20921, 20971..21109, 21155..21280, 21323..21420, 21470..21622, 21820..22046, 22113..22355, 22491..22732))
Map position2.37
Balancer
Map position of balancer
Sequence of primersIntRev:GTCATCAATGGCACCGTATA,ExtFwd:GTCTGGCATAGGCTCCCATG,ExtRev:CTCCGTTGAAACTCGTAATC,IntFwd:GCTCCCATGCCCTACAAACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Smith HK, Luo L, O'Halloran D, Guo D, Huang XY, Samuel AD, Hobert O.
Defining specificity determinants of cGMP mediated gustatory sensory transduction in Caenorhabditis elegans.
Genetics 2013 194(4) 885-901 
[ PubMed ID = 23695300 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr. Biol. 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet. 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]