Home > Mutants (Isolated) > tm1652

Mutants (Isolated)

Allele Name		tm1652
Allele Type		Normal
Sequence Name		ZK455.3
Gene Name		npr-9
Worm Base	Allele Name	tm1652
	Gene Name	npr-9
	Sequence	ZK455.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. L. Avery: feeding and satiety behavior normal. Dr. C. Bargmann: viable, fertile, less exploratory on food. Dr. I.D. Chin-Sang: PNAS 105, 1339 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10460/10461-CA-10778/10779 (318 bp deletion + 2 bp insertion)
Chromosome		X
Putative gene structure		join(8651..8705, 9843..10153, 10224..10379, 10444..10551, 10604..10744, 10791..10856, 11336..11555, 11609..11850, 12097..12132)
Map position		3.68
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CGGACGGTTTCTAAGCGATA,IntFwd:CATAACTCATCGGGCCAACT,ExtRev:CCTTCCCGGAAACTCTGCGA,IntRev:GACACGAATTGGTGTAGGCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Otarigho B, Butts AF, Aballay A. Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans. Elife 2024 12   [ PubMed ID = 38446031 ] [ RRC reference ] Campbell JC, Polan-Couillard LF, Chin-Sang ID, Bendena WG. NPR-9, a Galanin-Like G-Protein Coupled Receptor, and GLR-1 Regulate Interneuronal Circuitry Underlying Multisensory Integration of Environmental Cues in Caenorhabditis elegans. PLoS Genet 2016 12(5) e1006050  [ PubMed ID = 27223098 ] [ RRC reference ] Yu Y, Zhi L, Wu Q, Jing L, Wang D. NPR-9 regulates the innate immune response in Caenorhabditis elegans by antagonizing the activity of AIB interneurons. Cell Mol Immunol 2018 15(1) 27-37  [ PubMed ID = 27133473 ] [ RRC reference ] Campbell JC, Chin-Sang ID, Bendena WG. A Caenorhabditis elegans Nutritional-status Based Copper Aversion Assay. J Vis Exp 2017 (125)   [ PubMed ID = 28784963 ] [ RRC reference ] Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW. The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission. J Neurosci 2010 30(23) 7889-99  [ PubMed ID = 20534837 ] [ RRC reference ] Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR. A database of Caenorhabditis elegans behavioral phenotypes. Nat Methods 2013 10(9) 877-9  [ PubMed ID = 23852451 ] [ RRC reference ] Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R. Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans. J Neurosci 2013 33(35) 14107-16  [ PubMed ID = 23986246 ] [ RRC reference ] Luo J, Xu Z, Tan Z, Zhang Z, Ma L. Neuropeptide receptors NPR-1 and NPR-2 regulate Caenorhabditis elegans avoidance response to the plant stress hormone methyl salicylate. Genetics 2015 199(2) 523-31  [ PubMed ID = 25527285 ] [ RRC reference ] Harris G, Shen Y, Ha H, Donato A, Wallis S, Zhang X, Zhang Y. Dissecting the signaling mechanisms underlying recognition and preference of food odors. J Neurosci 2014 34(28) 9389-403  [ PubMed ID = 25009271 ] [ RRC reference ] Bendena WG, Boudreau JR, Papanicolaou T, Maltby M, Tobe SS, Chin-Sang ID. A Caenorhabditis elegans allatostatin/galanin-like receptor NPR-9 inhibits local search behavior in response to feeding cues. Proc Natl Acad Sci U S A 2008 105(4) 1339-42  [ PubMed ID = 18216257 ] [ RRC reference ]