Mutants (Isolated)

tm1647

Allele Nametm1647
Sequence NameW09C3.6
CGC Namegsp-3
Worm BaseAllele Name tm1647
CGC Name gsp-3
Sequence W09C3.6
Phenotypehomozygous viable. Dr. W. Schafer: fertile, locomotion grossly normal. Dr. G. Hermann: wild-type gut granules.
Mutation site13189/13190-14234/14235 (1045 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(13532..13600, 13648..14040, 14142..14597))
Map position-0.76
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTCCATCCAACAGAATGCA,IntFwd:CATGCTTTCCTTGTCGTACG,ExtRev:GAAACTATTCAGCCCGCGTT,IntRev:AGCCCGCGTTTTCAGGGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wu JC, Go AC, Samson M, Cintra T, Mirsoian S, Wu TF, Jow MM, Routman EJ, Chu DS.
Sperm development and motility are regulated by PP1 phosphatases in Caenorhabditis elegans.
Genetics 2012 190(1) 143-57 
[ PubMed ID = 22042574 ] [ RRC reference ]

Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]