Mutants (Isolated)

tm1642

Allele Nametm1642
Sequence NameB0336.7
CGC NameB0336.7
Worm BaseAllele Name tm1642
CGC Name B0336.7
Sequence B0336.7
Phenotypelethal or sterile. Dr. H. Zhang: accumulation of several germline P granule components in somatic cells.
Mutation site10165/10166-10595/10596 (430 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(7760..8231, 8676..9127, 9401..9609, 9741..9887, 10050..10266, 10316..10324))
Map position-1.45
BalancerhT2
Map position of balancer
Sequence of primersIntRev:CAGACGCTATCCCGATGTTA,IntFwd:GCTTTACAGCGGGCTCCCAT,ExtRev:ATATCGCAGATGCGCCAGTT,ExtFwd:TCGACAACTCAAACACGCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]

Zhang Y, Yan L, Zhou Z, Yang P, Tian E, Zhang K, Zhao Y, Li Z, Song B, Han J, Miao L, Zhang H.
SEPA-1 mediates the specific recognition and degradation of P granule components by autophagy in C. elegans.
Cell 2009 136(2) 308-21 
[ PubMed ID = 19167332 ] [ RRC reference ]