Mutants (Isolated)

tm1641

Allele Nametm1641
Sequence NameW03G1.1
CGC Nameglt-7
Worm BaseAllele Name tm1641
CGC Name glt-7
Sequence W03G1.1
Phenotypehomozygous viable. Dr. M. Driscoll: J. Biol. Chem. 282, 34412 (2007).
Mutation site28924/28925-TTT-29786/29787 (862 bp deletion + 3 bp insertion)
ChromosomeIV
Putative gene structurejoin(29249..29450, 29948..30316, 30357..30570, 31079..31274, 31416..31507, 31561..31692, 32327..32399, 32450..32557, 32617..32802)
Map position-25.84
Balancer
Map position of balancer
Sequence of primersIntRev:GGTATTATGCGCAGGCATCA,ExtRev:CGCTAGGCACGCAGGAATTA,IntFwd:CGCGTGGCCTTCATTCCGAA,ExtFwd:CTTTCTTCGCGTGGCCTTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mano I, Straud S, Driscoll M.
Caenorhabditis elegans glutamate transporters influence synaptic function and behavior at sites distant from the synapse.
J. Biol. Chem. 2007 282(47) 34412-9 
[ PubMed ID = 17681948 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]