Mutants (Isolated)

tm1634

Allele Nametm1634
Sequence NameH06H21.10
CGC Nametat-2
Worm BaseAllele Name tm1634
CGC Name tat-2
Sequence H06H21.10
Phenotypehomozygous viable. Dr. M. Han; fertile, normal growth.
Mutation site32600/32601-33351/33352 (751 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(21043..21078, 21494..21611, 21718..21815, 22337..22553, 22773..23101, 23909..24041, 24436..24829, 25605..25755, 25883..26031, 26077..26164, 27254..27397, 27604..27801, 27858..27983, 28790..29212, 30214..30282, 30419..30699, 31853..32108, 33083..33217, 33362..33460, 33510..33623, 33984..34094))
Map position1.36
Balancer
Map position of balancer
Sequence of primersExtFwd:GGACTAGGAACCACATCGTC,IntRev:AGTCGTCAACGAAATCCGCA,ExtRev:GGCTGAATCAAGTACAGCAA,IntFwd:CACATCGTCCCACGGTAGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu JL, Desjardins D, Branicky R, Agellon LB, Hekimi S.
Mitochondrial oxidative stress alters a pathway in Caenorhabditis elegans strongly resembling that of bile acid biosynthesis and secretion in vertebrates.
PLoS Genet. 2012 8(3) e1002553 
[ PubMed ID = 22438816 ] [ RRC reference ]

Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA.
An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases.
BMC Dev. Biol. 2008 8 96 
[ PubMed ID = 18831765 ] [ RRC reference ]