Mutants (Isolated)

tm1632

Allele Nametm1632
Sequence NameF55A4.9
CGC Namerncs-1
Worm BaseAllele Name tm1632
CGC Name rncs-1
Sequence F55A4.9
Phenotypehomozygous viable
Mutation site7194/7195-TTTTGTTTGGAAATAAAATTAGATTAGTGACAAATTCGTGTGGTGTTTTCTTTTTTCTACCACCCTTCCCTCCGAATTTGAACTGTGACACATTTTTTTTTGGGACGGAAACTAGTTTTTTGTTATTTTTGNAGGTCACACATATGTATCATAATAAAAAAGTTTANAATCAGGTGTTGAAATGTTGTTTTCAGAGAGGAATTTGAACTATTTCCGACATGAANATATTTTT-8009/8010 (815 bp deletion + 232 bp insertion)
ChromosomeX
Putative gene structurejoin(7339..7680, 7726..8185)
Map position-18.85
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTGCGCGACAGTTAGACGT,ExtRev:GTGAGATCTCTTGGCGCCAG,IntFwd:TAACGTTTCGAAGACCGGTG,IntRev:GCACGACACTGCAGTGCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hellwig S, Bass BL.
A starvation-induced noncoding RNA modulates expression of Dicer-regulated genes.
Proc. Natl. Acad. Sci. U.S.A. 2008 105(35) 12897-902 
[ PubMed ID = 18723671 ] [ RRC reference ]