Mutants (Isolated)

tm1625

Allele Nametm1625
Sequence NameC03D6.5
CGC Nameasfl-1
Worm BaseAllele Name tm1625
CGC Name asfl-1
Sequence C03D6.5
Phenotypehomozygous viable. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008). Dr. F.P. Finger: Dev. Biol.329, 64 (2009)
Mutation site1560/1561-2165/2166 (605 bp deletion)
ChromosomeI
Putative gene structurejoin(1448..1559, 1603..1934, 1969..2121, 2523..2693, 2743..2893, 2971..3071)
Map position3.84
Balancer
Map position of balancer
Sequence of primersExtFwd:CATCGGGCACCCAGATCACT,IntFwd:CTTTCTTGCACTCGTCCGTT,IntRev:GCGAAGATCTTCGGTTTCGA,ExtRev:TTGGGAATGTGGTGACGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Grigsby IF, Rutledge EM, Morton CA, Finger FP.
Functional redundancy of two C. elegans homologs of the histone chaperone Asf1 in germline DNA replication.
Dev Biol 2009 329(1) 64-79 
[ PubMed ID = 19233156 ] [ RRC reference ]