Mutants (Isolated)

tm1620

Allele Nametm1620
Sequence NameB0280.10
CGC Namepot-1
Worm BaseAllele Name tm1620
CGC Name pot-1
Sequence B0280.10
Phenotypehomozygous viable. Dr. J. Lee: increased telomere length.
Mutation site30598/30599-31354/31355 (756 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30101..30220, 30273..30365, 30415..30503, 30558..30706, 30852..30994, 31039..31119, 31177..31274, 31321..31468, 31515..31631))
Map position-0.79
Balancer
Map position of balancer
Sequence of primersIntRev:CACACCAATAAATTCCGCTC,ExtRev:TTCCGACAGCCAAGTACGTA,IntFwd:TGGCTAGGATTCGTACCTGA,ExtFwd:AACGGAACACTACCAACCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lackner DH, Raices M, Maruyama H, Haggblom C, Karlseder J.
Organismal propagation in the absence of a functional telomerase pathway in Caenorhabditis elegans.
EMBO J. 2012 31(8) 2024-33 
[ PubMed ID = 22425786 ] [ RRC reference ]

Raices M, Verdun RE, Compton SA, Haggblom CI, Griffith JD, Dillin A, Karlseder J.
C. elegans telomeres contain G-strand and C-strand overhangs that are bound by distinct proteins.
Cell 2008 132(5) 745-57 
[ PubMed ID = 18329362 ] [ RRC reference ]

Ferreira HC, Towbin BD, Jegou T, Gasser SM.
The shelterin protein POT-1 anchors Caenorhabditis elegans telomeres through SUN-1 at the nuclear periphery.
J. Cell Biol. 2013 203(5) 727-35 
[ PubMed ID = 24297748 ] [ RRC reference ]

Shtessel L, Lowden MR, Cheng C, Simon M, Wang K, Ahmed S.
Caenorhabditis elegans POT-1 and POT-2 repress telomere maintenance pathways.
G3 (Bethesda) 2013 3(2) 305-13 
[ PubMed ID = 23390606 ] [ RRC reference ]

Seo B, Kim C, Hills M, Sung S, Kim H, Kim E, Lim DS, Oh HS, Choi RMJ, Chun J, Shim J, Lee J.
Telomere maintenance through recruitment of internal genomic regions.
Nat Commun 2015 6 8189 
[ PubMed ID = 26382656 ] [ RRC reference ]

Cheng C, Shtessel L, Brady MM, Ahmed S.
Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(20) 7805-10 
[ PubMed ID = 22547822 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54 
[ PubMed ID = 18780750 ] [ RRC reference ]