Mutants (Isolated)

tm1619

Allele Nametm1619
Sequence NameF33D11.4
CGC Nameceh-12
Worm BaseAllele Name tm1619
CGC Name ceh-12
Sequence F33D11.4
Phenotypehomozygous viable. Dr. D.M. Miller: Genes & Dev. 21, 332 (2007)
Mutation site6901/6902-7992/7993 (1091 bp deletion)
ChromosomeI
Putative gene structurejoin(7073..7274, 7321..7413, 7508..7671, 8587..8670)
Map position0.47
Balancer
Map position of balancer
Sequence of primersIntRev:CAGTGAACCGAAATCACGTA,ExtRev:AAGCCTGGGGGTGAGAGAGA,IntFwd:GGGAATTGCCAAAACCATAG,ExtFwd:TTAAGCTGATGTGCACGGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Von Stetina SE, Fox RM, Watkins KL, Starich TA, Shaw JE, Miller DM 3rd.
UNC-4 represses CEH-12/HB9 to specify synaptic inputs to VA motor neurons in C. elegans.
Genes Dev. 2007 21(3) 332-46 
[ PubMed ID = 17289921 ] [ RRC reference ]