Mutants (Isolated)

tm1614

Allele Nametm1614
Allele TypeNormal
Sequence NameY48G1C.1
Gene NameY48G1C.1
Worm BaseAllele Name tm1614
Gene Name Y48G1C.1
Sequence Y48G1C.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Homozygous viable. Dr. M. Driscoll: no effect on necrotic cell death.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 45565/45566-46016/46017 (451 bp deletion)
ChromosomeI
Putative gene structurejoin(45603..45647, 45693..46067, 46120..46526, 46575..46719, 46780..47079, 47133..47225)
Map position-20.14
Balancer
Map position of balancer
Sequence of primersIntRev:GAAAGCGTCCTTCGGTAATA,ExtRev:ACAGACGGTGGCCACGTCTT,IntFwd:GAGTCCGATTTCTAGGGCAA,ExtFwd:AGCGATGGGACAAAGATCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Placentino M, de Jesus Domingues AM, Schreier J, Dietz S, Hellmann S, de Albuquerque BF, Butter F, Ketting RF.
Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo.
EMBO J 2021 40(3) e105280 
[ PubMed ID = 33231880 ] [ RRC reference ]