Mutants (Isolated)

tm1611

Allele Nametm1611
Sequence NameC49F5.2
CGC Nameset-6
Worm BaseAllele Name tm1611
CGC Name set-6
Sequence C49F5.2
Phenotypehomozygous viable. Dr. R.H. Horvitz: Development 134, 2991 (2007).
Mutation site15127/15128-15845/15846 (718 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(11611..11838, 11905..12024, 12559..13110, 13163..13294, 13825..14077, 14125..14432, 14578..14682, 14797..14898, 15474..15569, 15668..15811, 15894..15980))
Map position6.84
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCCAGACATCGAACAGCCA,IntFwd:ATAAACAGAGCTCTCGTGCT,ExtRev:CGCTCCTCTCACATTTGTCA,IntRev:CTGTTAGTACGTCTGCTCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Leight ER, Murphy JT, Fantz DA, Pepin D, Schneider DL, Ratliff TM, Mohammad DH, Herman MA, Kornfeld K.
Conversion of the LIN-1 ETS protein of Caenorhabditis elegans from a SUMOylated transcriptional repressor to a phosphorylated transcriptional activator.
Genetics 2015 199(3) 761-75 
[ PubMed ID = 25567989 ] [ RRC reference ]