Mutants (Isolated)

tm1598

Allele Nametm1598
Sequence NameY75B8A.30
CGC Namepph-4.1
Worm BaseAllele Name tm1598
CGC Name pph-4.1
Sequence Y75B8A.30
Phenotypelethal or sterile. Dr. K.F. O'Connell: Emb.
Mutation site281751/281752-282266/282267 (515 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(276460..276589, 279275..279516, 281408..281686, 281762..281887, 281946..282069, 282125..282225))
Map position16.78
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:GAGTCTACGAGCCCATTGTC,IntRev:CGCTTCCGTGGATCAATACT,IntFwd:TAGTACTAATCGACGGGGAT,ExtFwd:CCTGCTTCCGATCAATAACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Peters N, Perez DE, Song MH, Liu Y, Müller-Reichert T, Caron C, Kemphues KJ, O'Connell KF.
Control of mitotic and meiotic centriole duplication by the Plk4-related kinase ZYG-1.
J Cell Sci 2010 123(Pt 5) 795-805 
[ PubMed ID = 20144993 ] [ RRC reference ]

Sato-Carlton A, Li X, Crawley O, Testori S, Martinez-Perez E, Sugimoto A, Carlton PM.
Protein phosphatase 4 promotes chromosome pairing and synapsis, and contributes to maintaining crossover competence with increasing age.
PLoS Genet 2014 10(10) e1004638 
[ PubMed ID = 25340746 ] [ RRC reference ]