Mutants (Isolated)

tm1595

Allele Nametm1595
Allele TypeNormal
Sequence NameW06D4.5
Gene Namesnx-3
Worm BaseAllele Name tm1595
Gene Name snx-3
Sequence W06D4.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Hermann: wild-type gut granules. Dr. M. Hengartner: no altered DNA damage responses. Dr. M. Driscoll: normal dauer formation. Dr. Z. Zhou: no persistent cell corpses. Dr. S. Shaham: no obvious defects in glia development. Dr. H. Sawa: Egl, non-Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13634/13635-CA-14067/14068 (433 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(13664..13769, 13858..14078, 14125..14190, 14233..14328))
Map position3.46
Balancer
Map position of balancer
Sequence of primersExtFwd:ACCCATTCTCGTTCGCCGGT,IntFwd:TGGTGATGGGGACAAAGTAC,ExtRev:CGTTCGTCCTGAATATCCTA,IntRev:TAGACCCGTAGGGGTGCAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yoshida K, Suehiro Y, Dejima K, Yoshina S, Mitani S.
Distinct pathways for export of silencing RNA in Caenorhabditis elegans systemic RNAi.
iScience 2023 26(10) 108067 
[ PubMed ID = 37854694 ] [ RRC reference ]

Tian Y, Kang Q, Shi X, Wang Y, Zhang N, Ye H, Xu Q, Xu T, Zhang R.
SNX-3 mediates retromer-independent tubular endosomal recycling by opposing EEA-1-facilitated trafficking.
PLoS Genet 2021 17(6) e1009607 
[ PubMed ID = 34081703 ] [ RRC reference ]

Norris A, Tammineni P, Wang S, Gerdes J, Murr A, Kwan KY, Cai Q, Grant BD.
SNX-1 and RME-8 oppose the assembly of HGRS-1/ESCRT-0 degradative microdomains on endosomes.
Proc Natl Acad Sci U S A 2017 114(3) E307-E316 
[ PubMed ID = 28053230 ] [ RRC reference ]

Beer KB, Rivas-Castillo J, Kuhn K, Fazeli G, Karmann B, Nance JF, Stigloher C, Wehman AM.
Extracellular vesicle budding is inhibited by redundant regulators of TAT-5 flippase localization and phospholipid asymmetry.
Proc Natl Acad Sci U S A 2018 115(6) E1127-E1136 
[ PubMed ID = 29367422 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell Mol Life Sci 2018 75(11) 2027-2044 
[ PubMed ID = 29196797 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev Biol 2012 362(1) 42-9 
[ PubMed ID = 22138055 ] [ RRC reference ]

Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC.
A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion.
Nat Cell Biol 2011 13(8) 914-923 
[ PubMed ID = 21725319 ] [ RRC reference ]

Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell Signal 2014 26(1) 19-31 
[ PubMed ID = 24056045 ] [ RRC reference ]

Gleason RJ, Akintobi AM, Grant BD, Padgett RW.
BMP signaling requires retromer-dependent recycling of the type I receptor.
Proc Natl Acad Sci U S A 2014 111(7) 2578-83 
[ PubMed ID = 24550286 ] [ RRC reference ]

Bai Z, Grant BD.
A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling.
Proc Natl Acad Sci U S A 2015 112(12) E1443-52 
[ PubMed ID = 25775511 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol Biol Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]