Mutants (Isolated)

tm1595

Allele Name

tm1595

Sequence Name

W06D4.5

CGC Name

snx-3

Worm Base

Allele Name

tm1595

CGC Name

snx-3

Sequence

W06D4.5

Phenotype

homozygous viable. Dr. G. Hermann: wild-type gut granules. Dr. M. Hengartner: no altered DNA damage responses. Dr. M. Driscoll: normal dauer formation. Dr. Z. Zhou: no persistent cell corpses. Dr. S. Shaham: no obvious defects in glia development. Dr. H. Sawa: Egl, non-Psa.

Mutation site

13634/13635-CA-14067/14068 (433 bp deletion + 2 bp insertion)

Chromosome

Putative gene structure

complement(join(13664..13769, 13858..14078, 14125..14190, 14233..14328))

Map position

3.46

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ACCCATTCTCGTTCGCCGGT,IntFwd:TGGTGATGGGGACAAAGTAC,ExtRev:CGTTCGTCCTGAATATCCTA,IntRev:TAGACCCGTAGGGGTGCAAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Norris A, Tammineni P, Wang S, Gerdes J, Murr A, Kwan KY, Cai Q, Grant BD.
SNX-1 and RME-8 oppose the assembly of HGRS-1/ESCRT-0 degradative microdomains on endosomes.
Proc Natl Acad Sci U S A 2017 114(3) E307-E316
[ PubMed ID = 28053230 ] [ RRC reference ]

Beer KB, Rivas-Castillo J, Kuhn K, Fazeli G, Karmann B, Nance JF, Stigloher C, Wehman AM.
Extracellular vesicle budding is inhibited by redundant regulators of TAT-5 flippase localization and phospholipid asymmetry.
Proc Natl Acad Sci U S A 2018 115(6) E1127-E1136
[ PubMed ID = 29367422 ] [ RRC reference ]

Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC.
A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion.
Nat Cell Biol 2011 13(8) 914-923
[ PubMed ID = 21725319 ] [ RRC reference ]

Gleason RJ, Akintobi AM, Grant BD, Padgett RW.
BMP signaling requires retromer-dependent recycling of the type I receptor.
Proc Natl Acad Sci U S A 2014 111(7) 2578-83
[ PubMed ID = 24550286 ] [ RRC reference ]

Bai Z, Grant BD.
A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling.
Proc Natl Acad Sci U S A 2015 112(12) E1443-52
[ PubMed ID = 25775511 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell Mol Life Sci 2018 75(11) 2027-2044
[ PubMed ID = 29196797 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev Biol 2012 362(1) 42-9
[ PubMed ID = 22138055 ] [ RRC reference ]

Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell Signal 2014 26(1) 19-31
[ PubMed ID = 24056045 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol Biol Cell 2011 22(3) 354-74
[ PubMed ID = 21148288 ] [ RRC reference ]