Mutants (Isolated)

tm1589

Allele Nametm1589
Allele TypeNormal
Sequence NameR12E2.5
Gene Nameinx-16
Worm BaseAllele Name tm1589
Gene Name inx-16
Sequence R12E2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" slow growth. Dr. H. Sawa: Slow growth in larval stage, rare embryonic lehtality (2/100). Dr. E. Jorgensen: Current Biol. 17, 1601 (2007). Dr. C. Barmann: Sick, thin, very reduced brood size. High locomotion on food. Dr. C.P. Hunter: slow growth at 20C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14520/14521-14990/14991 (470 bp deletion)
ChromosomeI
Putative gene structurejoin(14464..14543, 14812..15043, 15491..16087, 16557..16716, 16776..16825)
Map position-1.67
Balancer
Map position of balancer
Sequence of primersIntRev:CCTGCAGTGGCGACAAGCAA,IntFwd:CAACGTCTCAGGCAGTCCCT,ExtRev:GGAATTCCCGATATCACCAG,ExtFwd:GGTCCTTTTGTCTGCCTATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim S, Sieburth D.
A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans.
Genetics 2019 211(4) 1283-1295 
[ PubMed ID = 30782598 ] [ RRC reference ]

Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI.
Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272 
[ PubMed ID = 28143932 ] [ RRC reference ]

Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW.
Six innexins contribute to electrical coupling of C. elegans body-wall muscle.
PLoS One 2013 8(10) e76877 
[ PubMed ID = 24130800 ] [ RRC reference ]

Nagy S, Huang YC, Alkema MJ, Biron D.
Caenorhabditis elegans exhibit a coupling between the defecation motor program and directed locomotion.
Sci Rep 2015 5 17174 
[ PubMed ID = 26597056 ] [ RRC reference ]

Peters MA, Teramoto T, White JQ, Iwasaki K, Jorgensen EM.
A calcium wave mediated by gap junctions coordinates a rhythmic behavior in C. elegans.
Curr Biol 2007 17(18) 1601-8 
[ PubMed ID = 17825560 ] [ RRC reference ]