Allele Name | tm1589 |
Allele Type | Normal |
Sequence Name | R12E2.5 |
Gene Name | inx-16 |
Worm Base | Allele Name |
tm1589
|
Gene Name |
inx-16
|
Sequence |
R12E2.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| slow growth. Dr. H. Sawa: Slow growth in larval stage, rare embryonic lehtality (2/100). Dr. E. Jorgensen: Current Biol. 17, 1601 (2007). Dr. C. Barmann: Sick, thin, very reduced brood size. High locomotion on food. Dr. C.P. Hunter: slow growth at 20C. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 14520/14521-14990/14991 (470 bp deletion) |
Chromosome | I |
Putative gene structure | join(14464..14543, 14812..15043, 15491..16087, 16557..16716, 16776..16825) |
Map position | -1.67 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:CCTGCAGTGGCGACAAGCAA,IntFwd:CAACGTCTCAGGCAGTCCCT,ExtRev:GGAATTCCCGATATCACCAG,ExtFwd:GGTCCTTTTGTCTGCCTATC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Kim S, Sieburth D. A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans. Genetics 2019 211(4) 1283-1295
[ PubMed ID = 30782598 ]
[ RRC reference ]
|
Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI. Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272
[ PubMed ID = 28143932 ]
[ RRC reference ]
|
Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW. Six innexins contribute to electrical coupling of C. elegans body-wall muscle. PLoS One 2013 8(10) e76877
[ PubMed ID = 24130800 ]
[ RRC reference ]
|
Nagy S, Huang YC, Alkema MJ, Biron D. Caenorhabditis elegans exhibit a coupling between the defecation motor program and directed locomotion. Sci Rep 2015 5 17174
[ PubMed ID = 26597056 ]
[ RRC reference ]
|
Peters MA, Teramoto T, White JQ, Iwasaki K, Jorgensen EM. A calcium wave mediated by gap junctions coordinates a rhythmic behavior in C. elegans. Curr Biol 2007 17(18) 1601-8
[ PubMed ID = 17825560 ]
[ RRC reference ]
|
|