Mutants (Isolated)

tm1582

Allele Nametm1582
Sequence NameW01G7.5
CGC Namelem-2
Worm BaseAllele Name tm1582
CGC Name lem-2
Sequence W01G7.5
Phenotypehomozygous viable. Dr. M. Hengartner: normal sensitivity to X-radiation. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior but shows synthetic nuclear anchoring defect with emr-1 (gk119).
Mutation site[W01G7] 32536/32537-A-[Y39G8C] 509/510 (838 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurejoin(32472..32612, 32669..32965, AL032634.2:99..825, AL032634.2:1671..2008)
Map position22.36
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGCGTCGGTACAACGTGAG,IntFwd:GGCTTTCAGCTCATCGGGCA,ExtRev:GCAGTTTTCGGGCGATGCGT,IntRev:TGCGTTGTTGTCAGCGCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Morales-Martínez A, Dobrzynska A, Askjaer P.
Inner nuclear membrane protein LEM-2 is required for correct nuclear separation and morphology in C. elegans.
J. Cell. Sci. 2015 128(6) 1090-6 
[ PubMed ID = 25653391 ] [ RRC reference ]

González-Aguilera C, Ikegami K, Ayuso C, de Luis A, Íñiguez M, Cabello J, Lieb JD, Askjaer P.
Genome-wide analysis links emerin to neuromuscular junction activity in Caenorhabditis elegans.
Genome Biol. 2014 15(2) R21 
[ PubMed ID = 24490688 ] [ RRC reference ]

Barkan R, Zahand AJ, Sharabi K, Lamm AT, Feinstein N, Haithcock E, Wilson KL, Liu J, Gruenbaum Y.
Ce-emerin and LEM-2: essential roles in Caenorhabditis elegans development, muscle function, and mitosis.
Mol. Biol. Cell 2012 23(4) 543-52 
[ PubMed ID = 22171324 ] [ RRC reference ]

Bone CR, Tapley EC, Gorjánácz M, Starr DA.
The Caenorhabditis elegans SUN protein UNC-84 interacts with lamin to transfer forces from the cytoplasm to the nucleoskeleton during nuclear migration.
Mol. Biol. Cell 2014 25(18) 2853-65 
[ PubMed ID = 25057012 ] [ RRC reference ]

Dittrich CM, Kratz K, Sendoel A, Gruenbaum Y, Jiricny J, Hengartner MO.
LEM-3 - A LEM domain containing nuclease involved in the DNA damage response in C. elegans.
PLoS ONE 2012 7(2) e24555 
[ PubMed ID = 22383942 ] [ RRC reference ]

Mattout A, Pike BL, Towbin BD, Bank EM, Gonzalez-Sandoval A, Stadler MB, Meister P, Gruenbaum Y, Gasser SM.
An EDMD mutation in C. elegans lamin blocks muscle-specific gene relocation and compromises muscle integrity.
Curr. Biol. 2011 21(19) 1603-14 
[ PubMed ID = 21962710 ] [ RRC reference ]