Mutants (Isolated)

tm1579

Allele Nametm1579
Sequence NameF32A11.2
CGC Namehpr-17
Worm BaseAllele Name tm1579
CGC Name hpr-17
Sequence F32A11.2
Phenotypehomozygous viable. Dr. M. Hengartner: sensitive to ionizing radiation and defective in the cell cycle arrest response and the induction of apoptosis.
Mutation site25612/25613-26350/26351 (738 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(23377..23662, 23719..23842, 23889..24075, 25192..25617, 26240..26589, 26641..26722, 26774..26863))
Map position14.59
Balancer
Map position of balancer
Sequence of primersExtFwd:TTCGAACGGGCTGCGACACA,IntFwd:CTCAGAAGTCATACTCGACA,ExtRev:CTGCGTCCGCCATTTATCTG,IntRev:CGGTGCAGGTCACCGATAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Boerckel J, Walker D, Ahmed S.
The Caenorhabditis elegans Rad17 homolog HPR-17 is required for telomere replication.
Genetics 2007 176(1) 703-9 
[ PubMed ID = 17339221 ] [ RRC reference ]

Cheng C, Shtessel L, Brady MM, Ahmed S.
Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(20) 7805-10 
[ PubMed ID = 22547822 ] [ RRC reference ]

Bailly AP, Freeman A, Hall J, D├ęclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet. 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]