Home > Mutants (Isolated) > tm1572

Mutants (Isolated)

Allele Name		tm1572
Allele Type		Normal
Sequence Name		T27A3.1
Gene Name		trak-1
Worm Base	Allele Name	tm1572
	Gene Name	trak-1
	Sequence	T27A3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozyogous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		25235/25236-TTA-25941/25942 (706 bp deletion + 3 bp insertion)
Chromosome		I
Putative gene structure		join(23989..24083, 24521..24644, 24812..24885, 25045..25170, 25346..25405, 25737..25956, 26007..26178, 26227..26405, 26452..26622, 26669..26789, 26844..26992, 27050..27118, 27303..27443, 27809..27931)
Map position		0.79
Balancer
Map position of balancer
Sequence of primers		ExtRev:ACGCAAGGGAGTCATAGAGA,IntFwd:CCTGGCTCTGGGAATGAATA,ExtFwd:TGGGTTGGAAACACTCTGTG,IntRev:TTAGCCATGAGCTCCGCGTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Chen YC, Huang HR, Hsu CH, Ou CY. CRMP/UNC-33 organizes microtubule bundles for KIF5-mediated mitochondrial distribution to axon. PLoS Genet 2021 17(2) e1009360  [ PubMed ID = 33571181 ] [ RRC reference ] Norflus F, Bu J, Guyton E, Gutekunst CA. Behavioral analysis of the huntingtin-associated protein 1 ortholog trak-1 in Caenorhabditis elegans. J Neurosci Res 2016 94(9) 850-6  [ PubMed ID = 27319755 ] [ RRC reference ] Yogev S, Maeder CI, Cooper R, Horowitz M, Hendricks AG, Shen K. Local inhibition of microtubule dynamics by dynein is required for neuronal cargo distribution. Nat Commun 2017 8 15063  [ PubMed ID = 28406181 ] [ RRC reference ] Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y. A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans. Front Neurosci 2017 11 263  [ PubMed ID = 28539870 ] [ RRC reference ]