Mutants (Isolated)

tm1572

Allele Nametm1572
Sequence NameT27A3.1
CGC Nametrak-1
Worm BaseAllele Name tm1572
CGC Name trak-1
Sequence T27A3.1
Phenotypehomozyogous viable
Mutation site25235/25236-TTA-25941/25942 (706 bp deletion + 3 bp insertion)
ChromosomeI
Putative gene structurejoin(23989..24083, 24521..24644, 24812..24885, 25045..25170, 25346..25405, 25737..25956, 26007..26178, 26227..26405, 26452..26622, 26669..26789, 26844..26992, 27050..27118, 27303..27443, 27809..27931)
Map position0.79
Balancer
Map position of balancer
Sequence of primersExtRev:ACGCAAGGGAGTCATAGAGA,IntFwd:CCTGGCTCTGGGAATGAATA,ExtFwd:TGGGTTGGAAACACTCTGTG,IntRev:TTAGCCATGAGCTCCGCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Norflus F, Bu J, Guyton E, Gutekunst CA.
Behavioral analysis of the huntingtin-associated protein 1 ortholog trak-1 in Caenorhabditis elegans.
J Neurosci Res 2016 94(9) 850-6 
[ PubMed ID = 27319755 ] [ RRC reference ]

Yogev S, Maeder CI, Cooper R, Horowitz M, Hendricks AG, Shen K.
Local inhibition of microtubule dynamics by dynein is required for neuronal cargo distribution.
Nat Commun 2017 8 15063 
[ PubMed ID = 28406181 ] [ RRC reference ]

Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y.
A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans.
Front Neurosci 2017 11 263 
[ PubMed ID = 28539870 ] [ RRC reference ]