Mutants (Isolated)

tm1568

Allele Nametm1568
Sequence NameC53C7.1
CGC Namenpr-10
Worm BaseAllele Name tm1568
CGC Name npr-10
Sequence C53C7.1
Phenotypehomozygous viable. Dr. H. R. Horvitz: WT for gross morphology, locomotion and growth rate.
Mutation site2465/2466-3039/3040 (574 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(608..697, 754..868, 1147..1277, 1849..2033, 2087..2256, 2303..2385, 2612..2816, 3633..3751))
Map position9.67
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGGGAAGCGCTGAGTAATC,IntFwd:AGCCAACAGATGGCAGCCAT,ExtRev:ATTGCGGTAAGAGTGGGGTG,IntRev:GTGTACCACCAGATGAGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]