Home > Mutants (Isolated) > tm1563

Mutants (Isolated)

Allele Name		tm1563
Allele Type		Normal
Sequence Name		K02H8.1
Gene Name		mbl-1
Worm Base	Allele Name	tm1563
	Gene Name	mbl-1
	Sequence	K02H8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		22806/22807-23319/23320 (513 bp deletion)
Chromosome		X
Putative gene structure		join(23114..23233, 24072..24200, 26162..26326, 28253..28306, 28356..28580, 29583..29744)
Map position		24.07
Balancer
Map position of balancer
Sequence of primers		ExtRev:GGGGCATCGAAATTTGCCAT,IntFwd:ACTGGTTTTCAATCAGGCCA,IntRev:AAGTAGGTCGTACAGCACTA,ExtFwd:TCACAGCAATCATCCCGATG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Lee HMT, Lim HY, He H, Lau CY, Zheng C. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLoS Genet 2024 20(10) e1011276  [ PubMed ID = 39423233 ] [ RRC reference ] Verbeeren J, Teixeira J, Garcia SMDA. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLoS Genet 2023 19(12) e1011109  [ PubMed ID = 38134228 ] [ RRC reference ] Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLoS Genet 2023 19(8) e1010885  [ PubMed ID = 37603562 ] [ RRC reference ] Matilainen O, Ribeiro ARS, Verbeeren J, Cetinbas M, Sood H, Sadreyev RI, Garcia SMDA. Loss of muscleblind splicing factor shortens Caenorhabditis elegans lifespan by reducing the activity of p38 MAPK/PMK-1 and transcription factors ATF-7 and Nrf/SKN-1. Genetics 2021 219(2)   [ PubMed ID = 34849877 ] [ RRC reference ] Spilker KA, Wang GJ, Tugizova MS, Shen K. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Dev 2012 7 7  [ PubMed ID = 22314215 ] [ RRC reference ] Sasagawa N, Ohno E, Kino Y, Watanabe Y, Ishiura S. Identification of Caenorhabditis elegans K02H8.1 (CeMBL), a functional ortholog of mammalian MBNL proteins. J Neurosci Res 2009 87(5) 1090-7  [ PubMed ID = 19021294 ] [ RRC reference ]