Mutants (Isolated)

tm1563

Allele Nametm1563
Allele TypeNormal
Sequence NameK02H8.1
Gene Namembl-1
Worm BaseAllele Name tm1563
Gene Name mbl-1
Sequence K02H8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22806/22807-23319/23320 (513 bp deletion)
ChromosomeX
Putative gene structurejoin(23114..23233, 24072..24200, 26162..26326, 28253..28306, 28356..28580, 29583..29744)
Map position24.07
Balancer
Map position of balancer
Sequence of primersExtRev:GGGGCATCGAAATTTGCCAT,IntFwd:ACTGGTTTTCAATCAGGCCA,IntRev:AAGTAGGTCGTACAGCACTA,ExtFwd:TCACAGCAATCATCCCGATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lee HMT, Lim HY, He H, Lau CY, Zheng C.
MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans.
PLoS Genet 2024 20(10) e1011276 
[ PubMed ID = 39423233 ] [ RRC reference ]

Verbeeren J, Teixeira J, Garcia SMDA.
The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism.
PLoS Genet 2023 19(12) e1011109 
[ PubMed ID = 38134228 ] [ RRC reference ]

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885 
[ PubMed ID = 37603562 ] [ RRC reference ]

Matilainen O, Ribeiro ARS, Verbeeren J, Cetinbas M, Sood H, Sadreyev RI, Garcia SMDA.
Loss of muscleblind splicing factor shortens Caenorhabditis elegans lifespan by reducing the activity of p38 MAPK/PMK-1 and transcription factors ATF-7 and Nrf/SKN-1.
Genetics 2021 219(2)  
[ PubMed ID = 34849877 ] [ RRC reference ]

Spilker KA, Wang GJ, Tugizova MS, Shen K.
Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation.
Neural Dev 2012 7 7 
[ PubMed ID = 22314215 ] [ RRC reference ]

Sasagawa N, Ohno E, Kino Y, Watanabe Y, Ishiura S.
Identification of Caenorhabditis elegans K02H8.1 (CeMBL), a functional ortholog of mammalian MBNL proteins.
J Neurosci Res 2009 87(5) 1090-7 
[ PubMed ID = 19021294 ] [ RRC reference ]