Mutants (Isolated)

tm1560

Allele Nametm1560
Sequence NameZC155.7
CGC Namesyn-16
Worm BaseAllele Name tm1560
CGC Name syn-16
Sequence ZC155.7
Phenotypehomozygous viable. Dr. S. Eimer: normal levamisole receptor trafficking.
Mutation site9086/9087-TCAA-10112/10113 (1027 bp deletion + 4 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(9253..9418, 9464..9717, 9765..9906, 9957..10215, 10345..10513))
Map position-1.95
Balancer
Map position of balancer
Sequence of primersExtRev:ATCGCAGCCGATATGCAAGA,IntRev:TCGTTCGCTGGATAACGTCA,ExtFwd:AAATAGAGGCCCGAACAGAG,IntFwd:ACTTTAGGCCAATGCAGCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gengyo-Ando K, Kuroyanagi H, Kobayashi T, Murate M, Fujimoto K, Okabe S, Mitani S.
The SM protein VPS-45 is required for RAB-5-dependent endocytic transport in Caenorhabditis elegans.
EMBO Rep. 2007 8(2) 152-7 
[ PubMed ID = 17235359 ] [ RRC reference ]