Mutants (Isolated)

tm1552

Allele Name

tm1552

Sequence Name

F16F9.5

CGC Name

mec-10

Worm Base

Allele Name

tm1552

CGC Name

mec-10

Sequence

F16F9.5

Phenotype

homozygous viable. Dr. M. Driscoll: touch insensitive.

Mutation site

30081/30082-30529/30530 (448 bp deletion)

Chromosome

Putative gene structure

complement(join(27406..27579, 27668..27743, 27791..27919, 28137..28312, 28470..28565, 28627..28787, 29053..29153, 29197..29271, 29322..29404, 29454..29546, 29822..29898, 30056..30125, 30229..30525, 30576..30658, 30864..30985, 31232..31324, 31372..31640))

Map position

0.01

Balancer

Map position of balancer

Sequence of primers

ExtRev:TGCTTGGGCAAGCTCCAAAC,IntRev:TGGGAGGGAGCTTCATCTTA,ExtFwd:GGTCCAGCTCTCACACTGGA,IntFwd:GTAGGGTCTGCAACTAGCTC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Tao L, Porto D, Li Z, Fechner S, Lee SA, Goodman MB, Xu XZS, Lu H, Shen K.
Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans.
Dev Cell 2019 51(5) 617-631.e3
[ PubMed ID = 31735664 ] [ RRC reference ]

Gonzales DL, Zhou J, Fan B, Robinson JT.
A microfluidic-induced C. elegans sleep state.
Nat Commun 2019 10(1) 5035
[ PubMed ID = 31695031 ] [ RRC reference ]

Shi S, Luke CJ, Miedel MT, Silverman GA, Kleyman TR.
Activation of the Caenorhabditis elegans Degenerin Channel by Shear Stress Requires the MEC-10 Subunit.
J Biol Chem 2016 291(27) 14012-14022
[ PubMed ID = 27189943 ] [ RRC reference ]

Sood P, Murthy K, Kumar V, Nonet ML, Menon GI, Koushika SP.
Cargo crowding at actin-rich regions along axons causes local traffic jams.
Traffic 2018 19(3) 166-181
[ PubMed ID = 29178177 ] [ RRC reference ]

Chatzigeorgiou M, Yoo S, Watson JD, Lee WH, Spencer WC, Kindt KS, Hwang SW, Miller DM 3rd, Treinin M, Driscoll M, Schafer WR.
Specific roles for DEG/ENaC and TRP channels in touch and thermosensation in C. elegans nociceptors.
Nat Neurosci 2010 13(7) 861-8
[ PubMed ID = 20512132 ] [ RRC reference ]

Chatzigeorgiou M, Grundy L, Kindt KS, Lee WH, Driscoll M, Schafer WR.
Spatial asymmetry in the mechanosensory phenotypes of the C. elegans DEG/ENaC gene mec-10.
J Neurophysiol 2010 104(6) 3334-44
[ PubMed ID = 20881202 ] [ RRC reference ]

Albeg A, Smith CJ, Chatzigeorgiou M, Feitelson DG, Hall DH, Schafer WR, Miller DM 3rd, Treinin M.
C. elegans multi-dendritic sensory neurons: morphology and function.
Mol Cell Neurosci 2011 46(1) 308-17
[ PubMed ID = 20971193 ] [ RRC reference ]

Husson SJ, Costa WS, Wabnig S, Stirman JN, Watson JD, Spencer WC, Akerboom J, Looger LL, Treinin M, Miller DM 3rd, Lu H, Gottschalk A.
Optogenetic analysis of a nociceptor neuron and network reveals ion channels acting downstream of primary sensors.
Curr Biol 2012 22(9) 743-52
[ PubMed ID = 22483941 ] [ RRC reference ]

Cohen E, Yemini E, Schafer W, Feitelson DG, Treinin M.
Locomotion analysis identifies roles of mechanosensory neurons in governing locomotion dynamics of C. elegans.
J Exp Biol 2012 215(Pt 20) 3639-48
[ PubMed ID = 22811252 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ] [ RRC reference ]

Sanders J, Nagy S, Fetterman G, Wright C, Treinin M, Biron D.
The Caenorhabditis elegans interneuron ALA is (also) a high-threshold mechanosensor.
BMC Neurosci 2013 14 156
[ PubMed ID = 24341457 ] [ RRC reference ]

Li W, Kang L, Piggott BJ, Feng Z, Xu XZ.
The neural circuits and sensory channels mediating harsh touch sensation in Caenorhabditis elegans.
Nat Commun 2011 2 315
[ PubMed ID = 21587232 ] [ RRC reference ]

Rabinowitch I, Chatzigeorgiou M, Schafer WR.
A gap junction circuit enhances processing of coincident mechanosensory inputs.
Curr Biol 2013 23(11) 963-7
[ PubMed ID = 23707432 ] [ RRC reference ]

Mohammadi A, Byrne Rodgers J, Kotera I, Ryu WS.
Behavioral response of Caenorhabditis elegans to localized thermal stimuli.
BMC Neurosci 2013 14 66
[ PubMed ID = 23822173 ] [ RRC reference ]

Chatzigeorgiou M, Schafer WR.
Lateral facilitation between primary mechanosensory neurons controls nose touch perception in C. elegans.
Neuron 2011 70(2) 299-309
[ PubMed ID = 21521615 ] [ RRC reference ]

Arnadóttir J, O'Hagan R, Chen Y, Goodman MB, Chalfie M.
The DEG/ENaC protein MEC-10 regulates the transduction channel complex in Caenorhabditis elegans touch receptor neurons.
J Neurosci 2011 31(35) 12695-704
[ PubMed ID = 21880930 ] [ RRC reference ]

Russell J, Vidal-Gadea AG, Makay A, Lanam C, Pierce-Shimomura JT.
Humidity sensation requires both mechanosensory and thermosensory pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2014 111(22) 8269-74
[ PubMed ID = 24843133 ] [ RRC reference ]

Zhang W, Bianchi L, Lee WH, Wang Y, Israel S, Driscoll M.
Intersubunit interactions between mutant DEG/ENaCs induce synthetic neurotoxicity.
Cell Death Differ 2008 15(11) 1794-803
[ PubMed ID = 18670436 ] [ RRC reference ]