Mutants (Isolated)

tm1544

Allele Nametm1544
Sequence NameF30A10.5
CGC Namestl-1
Worm BaseAllele Name tm1544
CGC Name stl-1
Sequence F30A10.5
Phenotypehomozygous viable. Dr. M. Chalfie: non-Mec. Dr. C. Hunter: normal growth and developement at 20C.
Mutation site15201/15202-15756/15757 (555 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(14937..15261, 15343..15650, 15706..15873, 15916..16051, 16101..16147))
Map position3.77
Balancer
Map position of balancer
Sequence of primersExtRev:CGAGATCGGTTGGTTCTAAG,IntRev:CTGGGTGTGAGTACAAGTTG,ExtFwd:CCTTGAAGGCAGGCTTACAT,IntFwd:TGAACAATCCGACGGACTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ghose P, Park EC, Tabakin A, Salazar-Vasquez N, Rongo C.
Anoxia-reoxygenation regulates mitochondrial dynamics through the hypoxia response pathway, SKN-1/Nrf, and stomatin-like protein STL-1/SLP-2.
PLoS Genet. 2013 9(12) e1004063 
[ PubMed ID = 24385935 ] [ RRC reference ]