Mutants (Isolated)

tm1542

Allele Nametm1542
Sequence NameT06C12.6
CGC Namenhr-102
Worm BaseAllele Name tm1542
CGC Name nhr-102
Sequence T06C12.6
Phenotypehomozygous viable
Mutation site9396/9397-9778/9779 (382 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(7469..7716, 7890..8008, 8053..8144, 8216..8311, 8362..8691, 8738..8870, 9093..9173, 9517..9662))
Map position9.05
Balancer
Map position of balancer
Sequence of primersExtFwd:ACGGTCTGAGTTCAAGCAAC,IntFwd:CGCACCCTGATCTCAACGAC,ExtRev:AACTACGCATGGCGCCTGCA,IntRev:GCATGGCGCCTGCAAAAGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]