Mutants (Isolated)

tm1524

Allele Nametm1524
Sequence NameY47D3A.4
CGC Namecku-70
Worm BaseAllele Name tm1524
CGC Name cku-70
Sequence Y47D3A.4
Phenotypehomozygous viable. Dr. R.H. Horvitz: no increase of homologous recombination. Dr. S. Ahmed: Genetics 173, 1301-1317 (2006).
Mutation site28096/28097-AGAATGAAGTTAATTTCAAAAGGTG-28898/28899 (802 bp deletion + 25 bp insertion)
ChromosomeIII
Putative gene structurejoin(18677..18898, 18952..19054, 22066..22250, 23042..23176, 25911..26044, 26209..26393, 27564..27599, 27973..28221, 28700..28869, 29419..29722, 31086..31288, 32449..32598)
Map position6.63
Balancer
Map position of balancer
Sequence of primersExtRev:CCTTGGCGGTGGCCTAACTA,IntFwd:ATTCGCAACCGTCGTGATCT,ExtFwd:AAGACTCGATTCGCAACCGT,IntRev:CTTCCGATGACGTCCCCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fang EF, Hou Y, Lautrup S, Jensen MB, Yang B, SenGupta T, Caponio D, Khezri R, Demarest TG, Aman Y, Figueroa D, Morevati M, Lee HJ, Kato H, Kassahun H, Lee JH, Filippelli D, Okur MN, Mangerich A, Croteau DL, Maezawa Y, Lyssiotis CA, Tao J, Yokote K, Rusten TE, Mattson MP, Jasper H, Nilsen H, Bohr VA.
NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.
Nat Commun 2019 10(1) 5284 
[ PubMed ID = 31754102 ] [ RRC reference ]

Girard C, Roelens B, Zawadzki KA, Villeneuve AM.
Interdependent and separable functions of Caenorhabditis elegans MRN-C complex members couple formation and repair of meiotic DSBs.
Proc Natl Acad Sci U S A 2018 115(19) E4443-E4452 
[ PubMed ID = 29686104 ] [ RRC reference ]

Nelson G, Jones T, Ortloff L, Ford J, Nuñez D, Braby L.
Bystander signaling in C. elegans: proton microbeam studies.
J Radiat Res. 2014 55 Suppl 1 i118-i119 
[ PubMed ID = -1 ] [ RRC reference ]

Vermezovic J, Stergiou L, Hengartner MO, d'Adda di Fagagna F.
Differential regulation of DNA damage response activation between somatic and germline cells in Caenorhabditis elegans.
Cell Death Differ 2012 19(11) 1847-55 
[ PubMed ID = 22705849 ] [ RRC reference ]

Lawrence KS, Tapley EC, Cruz VE, Li Q, Aung K, Hart KC, Schwartz TU, Starr DA, Engebrecht J.
LINC complexes promote homologous recombination in part through inhibition of nonhomologous end joining.
J Cell Biol 2016 215(6) 801-821 
[ PubMed ID = 27956467 ] [ RRC reference ]

Lemmens BB, Johnson NM, Tijsterman M.
COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining.
PLoS Genet 2013 9(2) e1003276 
[ PubMed ID = 23408909 ] [ RRC reference ]

Macaisne N, Kessler Z, Yanowitz JL.
Meiotic Double-Strand Break Proteins Influence Repair Pathway Utilization.
Genetics 2018 210(3) 843-856 
[ PubMed ID = 30242011 ] [ RRC reference ]

Clejan I, Boerckel J, Ahmed S.
Developmental modulation of nonhomologous end joining in Caenorhabditis elegans.
Genetics 2006 173(3) 1301-17 
[ PubMed ID = 16702421 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54 
[ PubMed ID = 18780750 ] [ RRC reference ]