Mutants (Isolated)

tm1524

Allele Nametm1524
Sequence NameY47D3A.4
CGC Namecku-70
Worm BaseAllele Name tm1524
CGC Name cku-70
Sequence Y47D3A.4
Phenotypehomozygous viable. Dr. R.H. Horvitz: no increase of homologous recombination. Dr. S. Ahmed: Genetics 173, 1301-1317 (2006).
Mutation site28096/28097-AGAATGAAGTTAATTTCAAAAGGTG-28898/28899 (802 bp deletion + 25 bp insertion)
ChromosomeIII
Putative gene structurejoin(18677..18898, 18952..19054, 22066..22250, 23042..23176, 25911..26044, 26209..26393, 27564..27599, 27973..28221, 28700..28869, 29419..29722, 31086..31288, 32449..32598)
Map position6.63
Balancer
Map position of balancer
Sequence of primersExtRev:CCTTGGCGGTGGCCTAACTA,IntFwd:ATTCGCAACCGTCGTGATCT,ExtFwd:AAGACTCGATTCGCAACCGT,IntRev:CTTCCGATGACGTCCCCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nelson G, Jones T, Ortloff L, Ford J, Nuñez D, Braby L.
Bystander signaling in C. elegans: proton microbeam studies.
J Radiat Res. 2014 55 Suppl 1 i118-i119 
[ PubMed ID = -1 ] [ RRC reference ]

Girard C, Roelens B, Zawadzki KA, Villeneuve AM.
Interdependent and separable functions of Caenorhabditis elegans MRN-C complex members couple formation and repair of meiotic DSBs.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(19) E4443-E4452 
[ PubMed ID = 29686104 ] [ RRC reference ]

Clejan I, Boerckel J, Ahmed S.
Developmental modulation of nonhomologous end joining in Caenorhabditis elegans.
Genetics 2006 173(3) 1301-17 
[ PubMed ID = 16702421 ] [ RRC reference ]

Lemmens BB, Johnson NM, Tijsterman M.
COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining.
PLoS Genet. 2013 9(2) e1003276 
[ PubMed ID = 23408909 ] [ RRC reference ]

Vermezovic J, Stergiou L, Hengartner MO, d'Adda di Fagagna F.
Differential regulation of DNA damage response activation between somatic and germline cells in Caenorhabditis elegans.
Cell Death Differ. 2012 19(11) 1847-55 
[ PubMed ID = 22705849 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54 
[ PubMed ID = 18780750 ] [ RRC reference ]