Mutants (Isolated)

tm1516

Allele Nametm1516
Sequence NameF40G9.11
CGC Namemxl-2
Worm BaseAllele Name tm1516
CGC Name mxl-2
Sequence F40G9.11
Phenotypehomozygous viable. Dr. B. Conradt: slow growth at 15C.
Mutation site25942/25943-26627/26628 (685 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(25714..25887, 25942..26107, 26486..26571, 26625..26816))
Map position-26.93
Balancer
Map position of balancer
Sequence of primersExtFwd:CCACGCGATTTCAACCATTG,ExtRev:GACACACAATTCGCGGCGTT,IntFwd:AGACTACAGAGAAGGCCAGA,IntRev:GCTATGTTCGACATGGTCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Denzel MS, Lapierre LR, Mack HID.
Emerging topics in C. elegans aging research: Transcriptional regulation, stress response and epigenetics.
Mech Ageing Dev 2019 177 4-21 
[ PubMed ID = 30134144 ] [ RRC reference ]

Opperman KJ, Mulcahy B, Giles AC, Risley MG, Birnbaum RL, Tulgren ED, Dawson-Scully K, Zhen M, Grill B.
The HECT Family Ubiquitin Ligase EEL-1 Regulates Neuronal Function and Development.
Cell Rep 2017 19(4) 822-835 
[ PubMed ID = 28445732 ] [ RRC reference ]

Nakamura S, Karalay Ö, Jäger PS, Horikawa M, Klein C, Nakamura K, Latza C, Templer SE, Dieterich C, Antebi A.
Mondo complexes regulate TFEB via TOR inhibition to promote longevity in response to gonadal signals.
Nat Commun 2016 7 10944 
[ PubMed ID = 27001890 ] [ RRC reference ]

Botts MR, Cohen LB, Probert CS, Wu F, Troemel ER.
Microsporidia Intracellular Development Relies on Myc Interaction Network Transcription Factors in the Host.
G3 (Bethesda) 2016 6(9) 2707-16 
[ PubMed ID = 27402359 ] [ RRC reference ]

Johnson DW, Llop JR, Farrell SF, Yuan J, Stolzenburg LR, Samuelson AV.
The Caenorhabditis elegans Myc-Mondo/Mad complexes integrate diverse longevity signals.
PLoS Genet 2014 10(4) e1004278 
[ PubMed ID = 24699255 ] [ RRC reference ]

Pickett CL, Breen KT, Ayer DE.
A C. elegans Myc-like network cooperates with semaphorin and Wnt signaling pathways to control cell migration.
Dev Biol 2007 310(2) 226-39 
[ PubMed ID = 17826759 ] [ RRC reference ]