Mutants (Isolated)

tm1516

Allele Nametm1516
Sequence NameF40G9.11
CGC Namemxl-2
Worm BaseAllele Name tm1516
CGC Name mxl-2
Sequence F40G9.11
Phenotypehomozygous viable. Dr. B. Conradt: slow growth at 15°C.
Mutation site25942/25943-26627/26628 (685 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(25714..25887, 25942..26107, 26486..26571, 26625..26816))
Map position-26.93
Balancer
Map position of balancer
Sequence of primersExtFwd:CCACGCGATTTCAACCATTG,ExtRev:GACACACAATTCGCGGCGTT,IntFwd:AGACTACAGAGAAGGCCAGA,IntRev:GCTATGTTCGACATGGTCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Denzel MS, Lapierre LR, Mack HID.
Emerging topics in C. elegans aging research: Transcriptional regulation, stress response and epigenetics.
Mech. Ageing Dev. 2019 177 4-21 
[ PubMed ID = 30134144 ] [ RRC reference ]

Opperman KJ, Mulcahy B, Giles AC, Risley MG, Birnbaum RL, Tulgren ED, Dawson-Scully K, Zhen M, Grill B.
The HECT Family Ubiquitin Ligase EEL-1 Regulates Neuronal Function and Development.
Cell Rep 2017 19(4) 822-835 
[ PubMed ID = 28445732 ] [ RRC reference ]

Pickett CL, Breen KT, Ayer DE.
A C. elegans Myc-like network cooperates with semaphorin and Wnt signaling pathways to control cell migration.
Dev. Biol. 2007 310(2) 226-39 
[ PubMed ID = 17826759 ] [ RRC reference ]

Johnson DW, Llop JR, Farrell SF, Yuan J, Stolzenburg LR, Samuelson AV.
The Caenorhabditis elegans Myc-Mondo/Mad complexes integrate diverse longevity signals.
PLoS Genet. 2014 10(4) e1004278 
[ PubMed ID = 24699255 ] [ RRC reference ]