Mutants (Isolated)

tm1512

Allele Nametm1512
Sequence NameY39A1A.5
CGC Namerabx-5
Worm BaseAllele Name tm1512
CGC Name rabx-5
Sequence Y39A1A.5
Phenotypehomozygous viable. Dr. Y. Jin: normal behavior. Dr. B. Grant: Nature Cell Biol. 7, 559-569 (2005).
Mutation site8810/8811-9793/9794 (983 bp deletion)
ChromosomeIII
Putative gene structurejoin(8497..8559, 9470..9553, 9733..9848, 10170..10270, 10365..10416, 14130..14677, 15303..15440, 15752..16004, 16352..16433, 16754..16954)
Map position3.91
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGCGGCAGATGTTCTGTGT,IntFwd:ATTCCCCCAGATTGTGTATG,ExtRev:CCGGTGACGTGGAAGTTGGT,IntRev:TTGGTGAACTGGTTCCGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Audhya A, Desai A, Oegema K.
A role for Rab5 in structuring the endoplasmic reticulum.
J. Cell Biol. 2007 178(1) 43-56 
[ PubMed ID = 17591921 ] [ RRC reference ]

Sato M, Sato K, Fonarev P, Huang CJ, Liou W, Grant BD.
Caenorhabditis elegans RME-6 is a novel regulator of RAB-5 at the clathrin-coated pit.
Nat. Cell Biol. 2005 7(6) 559-69 
[ PubMed ID = 15895077 ] [ RRC reference ]

Dwivedi M, Sung H, Shen H, Park BJ, Lee S.
Disruption of endocytic pathway regulatory genes activates autophagy in C. elegans.
Mol. Cells 2011 31(5) 477-81 
[ PubMed ID = 21618079 ] [ RRC reference ]

Sann SB, Crane MM, Lu H, Jin Y.
Rabx-5 regulates RAB-5 early endosomal compartments and synaptic vesicles in C. elegans.
PLoS ONE 2012 7(6) e37930 
[ PubMed ID = 22675499 ] [ RRC reference ]