Mutants (Isolated)

tm1512

Allele Nametm1512
Sequence NameY39A1A.5
CGC Namerabx-5
Worm BaseAllele Name tm1512
CGC Name rabx-5
Sequence Y39A1A.5
Phenotypehomozygous viable. Dr. Y. Jin: normal behavior. Dr. B. Grant: Nature Cell Biol. 7, 559-569 (2005).
Mutation site8810/8811-9793/9794 (983 bp deletion)
ChromosomeIII
Putative gene structurejoin(8497..8559, 9470..9553, 9733..9848, 10170..10270, 10365..10416, 14130..14677, 15303..15440, 15752..16004, 16352..16433, 16754..16954)
Map position3.91
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGCGGCAGATGTTCTGTGT,IntFwd:ATTCCCCCAGATTGTGTATG,ExtRev:CCGGTGACGTGGAAGTTGGT,IntRev:TTGGTGAACTGGTTCCGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dwivedi M, Sung H, Shen H, Park BJ, Lee S.
Disruption of endocytic pathway regulatory genes activates autophagy in C. elegans.
Mol. Cells 2011 31(5) 477-81 
[ PubMed ID = 21618079 ] [ RRC reference ]

Sann SB, Crane MM, Lu H, Jin Y.
Rabx-5 regulates RAB-5 early endosomal compartments and synaptic vesicles in C. elegans.
PLoS ONE 2012 7(6) e37930 
[ PubMed ID = 22675499 ] [ RRC reference ]

Audhya A, Desai A, Oegema K.
A role for Rab5 in structuring the endoplasmic reticulum.
J. Cell Biol. 2007 178(1) 43-56 
[ PubMed ID = 17591921 ] [ RRC reference ]

Sato M, Sato K, Fonarev P, Huang CJ, Liou W, Grant BD.
Caenorhabditis elegans RME-6 is a novel regulator of RAB-5 at the clathrin-coated pit.
Nat. Cell Biol. 2005 7(6) 559-69 
[ PubMed ID = 15895077 ] [ RRC reference ]