Mutants (Isolated)

tm1508

Allele Nametm1508
Sequence NameT21E3.1
CGC Nameegg-4
Worm BaseAllele Name tm1508
CGC Name egg-4
Sequence T21E3.1
Phenotypehomozygous viable. Dr. A. Singson: Curr. Biol.19, 1752 (2009).
Mutation site2750/2751-3287/3288 (537 bp deletion)
ChromosomeI
Putative gene structurejoin(2303..2565, 2614..3491, 3540..4279, 4350..4639, 4716..4806)
Map position-2.09
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGCGAGATACGGTACGCGA,ExtFwd:GCTTCGATCCTCACCATGAG,IntRev:CAGGAACAGTAACGGCGGGA,ExtRev:GTCTGGAGCTTGATAGACAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Parry JM, Velarde NV, Lefkovith AJ, Zegarek MH, Hang JS, Ohm J, Klancer R, Maruyama R, Druzhinina MK, Grant BD, Piano F, Singson A.
EGG-4 and EGG-5 Link Events of the Oocyte-to-Embryo Transition with Meiotic Progression in C. elegans.
Curr. Biol. 2009 19(20) 1752-7 
[ PubMed ID = 19879147 ] [ RRC reference ]