Mutants (Isolated)

tm1502

Allele Nametm1502
Sequence NameDY3.2
CGC Namelmn-1
Worm BaseAllele Name tm1502
CGC Name lmn-1
Sequence DY3.2
Phenotypelethal or sterile. Dr. J. Liu & Dr. Y. Gruenbaum: Proc Natl Acad Sci U S A102, 16690-16695 (2005)
Mutation site4675/4676-5280/5281 (605 bp deletion)
ChromosomeI
Putative gene structurejoin(4728..4825, 4915..4999, 5048..5161, 5317..5550, 5603..6643, 6728..6856)
Map position3.07
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtRev:GCATCCGCAGACCAAACGGT,IntRev:GCATGTGGAGCGAGCTTCAT,ExtFwd:TCACGTTCGTGTGGCGCCTA,IntFwd:TGGCGCCTATGACGTTTCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Haithcock E, Dayani Y, Neufeld E, Zahand AJ, Feinstein N, Mattout A, Gruenbaum Y, Liu J.
Age-related changes of nuclear architecture in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2005 102(46) 16690-5 
[ PubMed ID = 16269543 ] [ RRC reference ]

Penfield L, Wysolmerski B, Mauro M, Farhadifar R, Martinez MA, Biggs R, Wu HY, Broberg C, Needleman D, Bahmanyar S.
Dynein-pulling forces counteract lamin-mediated nuclear stability during nuclear envelope repair.
Mol. Biol. Cell 2018   
[ PubMed ID = 29386297 ] [ RRC reference ]

Lyakhovetsky R, Gruenbaum Y.
Studying lamins in invertebrate models.
Adv. Exp. Med. Biol. 2014 773 245-62 
[ PubMed ID = 24563351 ] [ RRC reference ]

Pan CL, Peng CY, Chen CH, McIntire S.
Genetic analysis of age-dependent defects of the Caenorhabditis elegans touch receptor neurons.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(22) 9274-9 
[ PubMed ID = 21571636 ] [ RRC reference ]

Bar DZ, Neufeld E, Feinstein N, Gruenbaum Y.
Gliotoxin reverses age-dependent nuclear morphology phenotypes, ameliorates motility, but fails to affect lifespan of adult Caenorhabditis elegans.
Cell Motil. Cytoskeleton 2009 66(10) 791-7 
[ PubMed ID = 19235201 ] [ RRC reference ]

Mattout A, Pike BL, Towbin BD, Bank EM, Gonzalez-Sandoval A, Stadler MB, Meister P, Gruenbaum Y, Gasser SM.
An EDMD mutation in C. elegans lamin blocks muscle-specific gene relocation and compromises muscle integrity.
Curr. Biol. 2011 21(19) 1603-14 
[ PubMed ID = 21962710 ] [ RRC reference ]

Link J, Paouneskou D, Velkova M, Daryabeigi A, Laos T, Labella S, Barroso C, Pacheco PiƱol S, Montoya A, Kramer H, Woglar A, Baudrimont A, Markert SM, Stigloher C, Martinez-Perez E, Dammermann A, Alsheimer M, Zetka M, Jantsch V.
Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase.
Dev. Cell 2018 45(2) 212-225.e7 
[ PubMed ID = 29689196 ] [ RRC reference ]