Mutants (Isolated)

tm1498

Allele Nametm1498
Sequence NameT22D1.12
CGC Namenpr-12
Worm BaseAllele Name tm1498
CGC Name npr-12
Sequence T22D1.12
Phenotypehomozygous viable. Dr. L. Avery: feeding and satiety behavior normal.
Mutation site38843/38844-C-39448/39449 (605 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(38266..38322, 38420..38518, 38614..38713, 38769..39118, 39530..39769, 39921..40175, 40222..40296))
Map position3.25
Balancer
Map position of balancer
Sequence of primersIntRev:GTATGCAACCGCCAAACTCT,ExtRev:ACCCCCTTTGGCAGTTTATG,IntFwd:TCGGTGGCACCCGAGAAATA,ExtFwd:CGTTGAGAAATCGGTGGCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
E L, Zhou T, Koh S, Chuang M, Sharma R, Pujol N, Chisholm AD, Eroglu C, Matsunami H, Yan D.
An Antimicrobial Peptide and Its Neuronal Receptor Regulate Dendrite Degeneration in Aging and Infection.
Neuron 2018 97(1) 125-138.e5 
[ PubMed ID = 29301098 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Cohen M, Reale V, Olofsson B, Knights A, Evans P, de Bono M.
Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling.
Cell Metab 2009 9(4) 375-85 
[ PubMed ID = 19356718 ] [ RRC reference ]