Mutants (Isolated)

tm1496

Allele Nametm1496
Sequence NameT23G7.5
CGC Namepir-1
Worm BaseAllele Name tm1496
CGC Name pir-1
Sequence T23G7.5
Phenotypelethal or sterile. Dr. C. Mello, Cell 124, 343-354 (2006)
Mutation site12300/12301-13009/13010 (709 bp deletion)
ChromosomeII
Putative gene structurejoin(12488..12654, 12851..13093, 13144..13241, 13297..13407, 13455..13621)
Map position1.02
BalancermIn1 [mIs14]
Map position of balancer
Sequence of primersExtFwd:CATCTACCCAGACTGCGGAT,IntFwd:CTATTCGTACTTCACCGGGA,ExtRev:CACTCCAACCGTCTCTCCAC,IntRev:ATCGGCTGAGTTTCCGCTGC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Duchaine TF, Wohlschlegel JA, Kennedy S, Bei Y, Conte D Jr, Pang K, Brownell DR, Harding S, Mitani S, Ruvkun G, Yates JR 3rd, Mello CC.
Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways.
Cell 2006 124(2) 343-54 
[ PubMed ID = 16439208 ] [ RRC reference ]

Nakagawa A, Shi Y, Kage-Nakadai E, Mitani S, Xue D.
Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease.
Science 2010 328(5976) 327-34 
[ PubMed ID = 20223951 ] [ RRC reference ]