Mutants (Isolated)

tm1479

Allele Nametm1479
Sequence NameT07G12.8
CGC NameT07G12.8
Worm BaseAllele Name tm1479
CGC Name T07G12.8
Sequence T07G12.8
PhenotypeHomozygous viable. Dr. A. Dernburg: does not remove CDS, results in a weak loss-of-function, based on antibody staining and some missegregation of chromosome II and III. Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).
Mutation site25286/25287-T-25874/25875 (588 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurejoin(25245..25308, 25357..25736)
Map position4.62
Balancer
Map position of balancer
Sequence of primersIntRev:TCTATCTGGAGTGCTCCACT,IntFwd:CGAAGACAGTCAGATGGGAC,ExtRev:CGGATCCCTCCACAATCCAA,ExtFwd:GTTCCAGCGAAGACAGTCAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev. Cell 2006 11(6) 817-29 
[ PubMed ID = 17141157 ] [ RRC reference ]