Mutants (Isolated)

tm1473

Allele Nametm1473
Sequence NameT01B10.4a
CGC Namenhr-14
Worm BaseAllele Name tm1473
CGC Name nhr-14
Sequence T01B10.4a
Phenotypehomozygous viable. Dr. S.S. Lee: no developmental or lifespan phenotype. Dr. X. Wang: normal apoptosis.
Mutation site6666/6667-7075/7076 (409 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(5772..5822, 5877..6072, 6123..6610, 6996..7196, 7251..7482, 7552..7691))
Map position0.01
Balancer
Map position of balancer
Sequence of primersIntFwd:TAGGGTTACTGTAACGCGAG,ExtRev:AGGCATCTCGTGTGTAGTGT,ExtFwd:CTCGAGAGGTGGAGTCTCAC,IntRev:CGGCAATGGAAGAGACCCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mimoto A, Fujii M, Usami M, Shimamura M, Hirabayashi N, Kaneko T, Sasagawa N, Ishiura S.
Identification of an estrogenic hormone receptor in Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2007 364(4) 883-8 
[ PubMed ID = 17963693 ] [ RRC reference ]

Allard P, Colaiácovo MP.
Bisphenol A impairs the double-strand break repair machinery in the germline and causes chromosome abnormalities.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(47) 20405-10 
[ PubMed ID = 21059909 ] [ RRC reference ]

Sugi T, Nishida Y, Mori I.
Regulation of behavioral plasticity by systemic temperature signaling in Caenorhabditis elegans.
Nat. Neurosci. 2011 14(8) 984-92 
[ PubMed ID = 21706021 ] [ RRC reference ]