Mutants (Isolated)

tm1458

Allele Nametm1458
Sequence NameF10B5.5
CGC Namepch-2
Worm BaseAllele Name tm1458
CGC Name pch-2
Sequence F10B5.5
Phenotypehomozygous viable. Dr. A. Dernburg: Science 310, 1683-1686 (2005). Dr. A. Gartner: Curr.Biol. 16, R249-R251 (2006).
Mutation site19276/19277-AAAAGCCGAAAAA-19788/19789 (512 bp deletion + 13 bp insertion)
ChromosomeII
Putative gene structurejoin(19234..19295, 19349..19470, 19519..20093, 20147..20467, 20514..20708)
Map position0.72
Balancer
Map position of balancer
Sequence of primersExtFwd:AACTTGGGAAGACCGCACAG,IntRev:GCCAGATAACGATGCAGGAA,ExtRev:GCACAAGAGCCAGATAACGA,IntFwd:AGCGTACAGCTCTTCAGATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bhalla N, Dernburg AF.
A conserved checkpoint monitors meiotic chromosome synapsis in Caenorhabditis elegans.
Science 2005 310(5754) 1683-6 
[ PubMed ID = 16339446 ] [ RRC reference ]

Penkner A, Tang L, Novatchkova M, Ladurner M, Fridkin A, Gruenbaum Y, Schweizer D, Loidl J, Jantsch V.
The nuclear envelope protein Matefin/SUN-1 is required for homologous pairing in C. elegans meiosis.
Dev. Cell 2007 12(6) 873-85 
[ PubMed ID = 17543861 ] [ RRC reference ]

Mei F, Chen PF, Dombecki CR, Aljabban I, Nabeshima K.
A Defective Meiotic Outcome of a Failure in Homologous Pairing and Synapsis Is Masked by Meiotic Quality Control.
PLoS ONE 2015 10(8) e0134871 
[ PubMed ID = 26247362 ] [ RRC reference ]

Nelson CR, Hwang T, Chen PH, Bhalla N.
TRIP13PCH-2 promotes Mad2 localization to unattached kinetochores in the spindle checkpoint response.
J. Cell Biol. 2015 211(3) 503-16 
[ PubMed ID = 26527744 ] [ RRC reference ]

Stevens D, Oegema K, Desai A.
Meiotic double-strand breaks uncover and protect against mitotic errors in the C. elegans germline.
Curr. Biol. 2013 23(23) 2400-6 
[ PubMed ID = 24239117 ] [ RRC reference ]

Lamelza P, Bhalla N.
Histone methyltransferases MES-4 and MET-1 promote meiotic checkpoint activation in Caenorhabditis elegans.
PLoS Genet. 2012 8(11) e1003089 
[ PubMed ID = 23166523 ] [ RRC reference ]

Brockway H, Balukoff N, Dean M, Alleva B, Smolikove S.
The CSN/COP9 signalosome regulates synaptonemal complex assembly during meiotic prophase I of Caenorhabditis elegans.
PLoS Genet. 2014 10(11) e1004757 
[ PubMed ID = 25375142 ] [ RRC reference ]

Turcotte CA, Sloat SA, Rigothi JA, Rosenkranse E, Northrup AL, Andrews NP, Checchi PM.
Maintenance of Genome Integrity by Mi2 Homologs CHD-3 and LET-418 in Caenorhabditis elegans.
Genetics 2018 208(3) 991-1007 
[ PubMed ID = 29339410 ] [ RRC reference ]

Deshong AJ, Ye AL, Lamelza P, Bhalla N.
A quality control mechanism coordinates meiotic prophase events to promote crossover assurance.
PLoS Genet. 2014 10(4) e1004291 
[ PubMed ID = 24762417 ] [ RRC reference ]

Ye AL, Ragle JM, Conradt B, Bhalla N.
Differential regulation of germline apoptosis in response to meiotic checkpoint activation.
Genetics 2014 198(3) 995-1000 
[ PubMed ID = 25217053 ] [ RRC reference ]

McManus CE, Reinke V.
The Germline-Specific Factor OEF-1 Facilitates Coordinated Progression Through Germ Cell Development in Caenorhabditis elegans.
Genetics 2018 208(2) 549-563 
[ PubMed ID = 29167199 ] [ RRC reference ]

Bohr T, Nelson CR, Klee E, Bhalla N.
Spindle assembly checkpoint proteins regulate and monitor meiotic synapsis in C. elegans.
J. Cell Biol. 2015 211(2) 233-42 
[ PubMed ID = 26483555 ] [ RRC reference ]

Checchi PM, Engebrecht J.
Caenorhabditis elegans histone methyltransferase MET-2 shields the male X chromosome from checkpoint machinery and mediates meiotic sex chromosome inactivation.
PLoS Genet. 2011 7(9) e1002267 
[ PubMed ID = 21909284 ] [ RRC reference ]

Morthorst TH, Olsen A.
Cell-nonautonomous inhibition of radiation-induced apoptosis by dynein light chain 1 in Caenorhabditis elegans.
Cell Death Dis 2013 4 e799 
[ PubMed ID = 24030151 ] [ RRC reference ]

Xu J, Sun X, Jing Y, Wang M, Liu K, Jian Y, Yang M, Cheng Z, Yang C.
MRG-1 is required for genomic integrity in Caenorhabditis elegans germ cells.
Cell Res. 2012 22(5) 886-902 
[ PubMed ID = 22212480 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet. 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]