Mutants (Isolated)

tm1453

Allele Nametm1453
Sequence NameT05F1.1
CGC Namedhs-4
Worm BaseAllele Name tm1453
CGC Name dhs-4
Sequence T05F1.1
Phenotypehomozygous viable
Mutation site1096/1097-TTGATAAA-1530/1531 (434 bp deletion + 8 bp insertion)
ChromosomeI
Putative gene structurejoin(64..141, 187..338, 386..512, 571..1114, 1166..1289, 1339..1921, 1971..2036)
Map position3.83
Balancer
Map position of balancer
Sequence of primersIntRev:GCGAGTGGGTAGCAATCTGT,ExtRev:CCCTCGATAGTGTTCTGCGA,IntFwd:GAGTTTCATGCGTACCGTCT,ExtFwd:TTTAGGTGAACGGGTCCCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Richard M, Boulin T, Robert VJ, Richmond JE, Bessereau JL.
Biosynthesis of ionotropic acetylcholine receptors requires the evolutionarily conserved ER membrane complex.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(11) E1055-63 
[ PubMed ID = 23431131 ] [ RRC reference ]

Almedom RB, Liewald JF, Hernando G, Schultheis C, Rayes D, Pan J, Schedletzky T, Hutter H, Bouzat C, Gottschalk A.
An ER-resident membrane protein complex regulates nicotinic acetylcholine receptor subunit composition at the synapse.
EMBO J. 2009 28(17) 2636-49 
[ PubMed ID = 19609303 ] [ RRC reference ]

Gottschalk A, Almedom RB, Schedletzky T, Anderson SD, Yates JR 3rd, Schafer WR.
Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans.
EMBO J. 2005 24(14) 2566-78 
[ PubMed ID = 15990870 ] [ RRC reference ]