Mutants (Isolated)

tm1452

Allele Nametm1452
Sequence NameZK1127.9
CGC Nametcer-1
Worm BaseAllele Name tm1452
CGC Name tcer-1
Sequence ZK1127.9
Phenotypehomozygous viable. Dr. C. Kenyon: reduced progeny and slightly delayed development. Dr. G. Ruvkun: non-Rde for pos-1 and unc-22 RNAi.
Mutation site15222/15223-AAAATTAAAA-15614/15615 (392 bp deletion + 10 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(11971..12038, 12093..12324, 12373..12819, 12874..14213, 14732..14918, 15414..15756, 15901..16001))
Map position0.35
Balancer
Map position of balancer
Sequence of primersIntRev:GTGTCCATCAGTCAAGACGA,ExtRev:ACCGACCTCTGATTCCTGGT,IntFwd:GCCAATTCTGGTTGAGTGAC,ExtFwd:CCTCTTCCGTGGCTCTATGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pérez-Jiménez MM, Monje-Moreno JM, Brokate-Llanos AM, Venegas-Calerón M, Sánchez-García A, Sansigre P, Valladares A, Esteban-García S, Suárez-Pereira I, Vitorica J, Ríos JJ, Artal-Sanz M, Carrión ÁM, Muñoz MJ.
Steroid hormones sulfatase inactivation extends lifespan and ameliorates age-related diseases.
Nat Commun 2021 12(1) 49 
[ PubMed ID = 33397961 ] [ RRC reference ]

Amrit FRG, Naim N, Ratnappan R, Loose J, Mason C, Steenberge L, McClendon BT, Wang G, Driscoll M, Yanowitz JL, Ghazi A.
The longevity-promoting factor, TCER-1, widely represses stress resistance and innate immunity.
Nat Commun 2019 10(1) 3042 
[ PubMed ID = 31316054 ] [ RRC reference ]

Amrit FR, Steenkiste EM, Ratnappan R, Chen SW, McClendon TB, Kostka D, Yanowitz J, Olsen CP, Ghazi A.
DAF-16 and TCER-1 Facilitate Adaptation to Germline Loss by Restoring Lipid Homeostasis and Repressing Reproductive Physiology in C. elegans.
PLoS Genet 2016 12(2) e1005788 
[ PubMed ID = 26862916 ] [ RRC reference ]

Ewald CY, Marfil V, Li C.
Alzheimer-related protein APL-1 modulates lifespan through heterochronic gene regulation in Caenorhabditis elegans.
Aging Cell 2016 15(6) 1051-1062 
[ PubMed ID = 27557896 ] [ RRC reference ]

Pushpa K, Kumar GA, Subramaniam K.
PUF-8 and TCER-1 are essential for normal levels of multiple mRNAs in the C. elegans germline.
Development 2013 140(6) 1312-20 
[ PubMed ID = 23444359 ] [ RRC reference ]

Boulias K, Horvitz HR.
The C. elegans microRNA mir-71 acts in neurons to promote germline-mediated longevity through regulation of DAF-16/FOXO.
Cell Metab 2012 15(4) 439-50 
[ PubMed ID = 22482727 ] [ RRC reference ]

Sinha A, Rae R.
A functional genomic screen for evolutionarily conserved genes required for lifespan and immunity in germline-deficient C. elegans.
PLoS One 2014 9(8) e101970 
[ PubMed ID = 25093668 ] [ RRC reference ]

Ratnappan R, Amrit FR, Chen SW, Gill H, Holden K, Ward J, Yamamoto KR, Olsen CP, Ghazi A.
Germline signals deploy NHR-49 to modulate fatty-acid β-oxidation and desaturation in somatic tissues of C. elegans.
PLoS Genet 2014 10(12) e1004829 
[ PubMed ID = 25474470 ] [ RRC reference ]

Steinbaugh MJ, Narasimhan SD, Robida-Stubbs S, Moronetti Mazzeo LE, Dreyfuss JM, Hourihan JM, Raghavan P, Operaña TN, Esmaillie R, Blackwell TK.
Lipid-mediated regulation of SKN-1/Nrf in response to germ cell absence.
Elife 2015 4  
[ PubMed ID = 26196144 ] [ RRC reference ]

Ghazi A, Henis-Korenblit S, Kenyon C.
A transcription elongation factor that links signals from the reproductive system to lifespan extension in Caenorhabditis elegans.
PLoS Genet 2009 5(9) e1000639 
[ PubMed ID = 19749979 ] [ RRC reference ]