Mutants (Isolated)

tm1449

Allele Nametm1449
Sequence NameB0024.6
CGC Namegcy-6
Worm BaseAllele Name tm1449
CGC Name gcy-6
Sequence B0024.6
Phenotypehomozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. O. Hobert: Mg chemotaxis defective.
Mutation site26845/26846-27031/27302 (456 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(21722..21805, 21856..22100, 23485..24088, 24131..24219, 24264..24413, 24494..24815, 24853..25147, 25195..25528, 25611..25746, 25794..25913, 25963..26075, 26122..26253, 26301..26527, 26703..26835, 26888..26997, 27162..27271, 27312..27526, 27733..27799))
Map position2.47
Balancer
Map position of balancer
Sequence of primersExtRev:TTCGGGCATCGGTAGACAGA,IntRev:TCGGTAGACAGATAACCTGA,ExtFwd:CGCGCACGCATCTGTACAAT,IntFwd:GGGCCTGTAGCTTCAGTCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr Biol 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]