Allele Name | tm1449 |
Sequence Name | B0024.6 |
CGC Name | gcy-6 |
Worm Base | Allele Name |
tm1449
|
CGC Name |
gcy-6
|
Sequence |
B0024.6
|
Phenotype | homozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. O. Hobert: Mg chemotaxis defective. |
Mutation site | 26845/26846-27031/27302 (456 bp deletion) |
Chromosome | V |
Putative gene structure | complement(join(21722..21805, 21856..22100, 23485..24088, 24131..24219, 24264..24413, 24494..24815, 24853..25147, 25195..25528, 25611..25746, 25794..25913, 25963..26075, 26122..26253, 26301..26527, 26703..26835, 26888..26997, 27162..27271, 27312..27526, 27733..27799)) |
Map position | 2.47 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:TTCGGGCATCGGTAGACAGA,IntRev:TCGGTAGACAGATAACCTGA,ExtFwd:CGCGCACGCATCTGTACAAT,IntFwd:GGGCCTGTAGCTTCAGTCCA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N. Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans. Proc Natl Acad Sci U S A 2011 108(1) 254-9
[ PubMed ID = 21173231 ]
[ RRC reference ]
|
Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M. Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans. PLoS Genet 2011 7(10) e1002335
[ PubMed ID = 22022287 ]
[ RRC reference ]
|
Murayama T, Takayama J, Fujiwara M, Maruyama IN. Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans. Curr Biol 2013 23(11) 1007-12
[ PubMed ID = 23664973 ]
[ RRC reference ]
|
|