Mutants (Isolated)

tm1448

Allele Nametm1448
Sequence NameC18F3.2
CGC Namesax-7
Worm BaseAllele Name tm1448
CGC Name sax-7
Sequence C18F3.2
Phenotypehomozygous viable, small brood size.
Mutation site22599/22600-24324/24325 (1725 bp deletion)
ChromosomeIV
Putative gene structurejoin(8090..8191, 8289..8400, 8721..8898, 9235..9311, 9650..9942, 12837..12981, 20483..20773, 21541..21825, 22073..22363, 22578..22846, 23390..24194, 24434..24766, 27055..27225, 27634..27955, 28141..28256, 28310..28383)
Map position3.59
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:GTTCAACCATTCCCCCGTGT,IntFwd:AGTCTCTACCGGAGGATCGA,ExtRev:ATGCGCGAAGGGATCGAACT,IntRev:TACGAATTCCAACGCGAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang X, Kweon J, Larson S, Chen L.
A role for the C. elegans L1CAM homologue lad-1/sax-7 in maintaining tissue attachment.
Dev. Biol. 2005 284(2) 273-91 
[ PubMed ID = 16023097 ] [ RRC reference ]

Zhou S, Opperman K, Wang X, Chen L.
unc-44 Ankyrin and stn-2 gamma-syntrophin regulate sax-7 L1CAM function in maintaining neuronal positioning in Caenorhabditis elegans.
Genetics 2008 180(3) 1429-43 
[ PubMed ID = 18791240 ] [ RRC reference ]