Mutants (Isolated)

tm1446

Allele Nametm1446
Sequence NameT14F9.5
CGC Namelin-32
Worm BaseAllele Name tm1446
CGC Name lin-32
Sequence T14F9.5
Phenotypehomozygous viable. Low touch sensitivity at anterior body. Dr. D. Portman: strong ray-missing phenotype. Dr. O. Hobert: Nat. Meth.5, 869 (2008).
Mutation site24261/24262-24772/24773 (511 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(24191..24337, 24722..24860, 24926..25068))
Map position-16.75
Balancer
Map position of balancer
Sequence of primersIntRev:CGCGAGCATTCCTACTATTG,ExtFwd:TGTGTCGCCCGTTATCTTGA,IntFwd:TCTACCTACCGTAGACCCAG,ExtRev:TAGCCAATGCGCGAGCATTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Rojo Romanos T, Ng L, Pocock R.
Behavioral Assays to Study Oxygen and Carbon Dioxide Sensing in Caenorhabditis elegans.
Bio Protoc 2018 8(1)  
[ PubMed ID = 29335676 ] [ RRC reference ]

Doitsidou M, Flames N, Lee AC, Boyanov A, Hobert O.
Automated screening for mutants affecting dopaminergic-neuron specification in C. elegans.
Nat. Methods 2008 5(10) 869-72 
[ PubMed ID = 18758453 ] [ RRC reference ]

Sallee MD, Littleford HE, Greenwald I.
A bHLH Code for Sexually Dimorphic Form and Function of the C. elegans Somatic Gonad.
Curr. Biol. 2017 27(12) 1853-1860.e5 
[ PubMed ID = 28602651 ] [ RRC reference ]

Rojo Romanos T, Pladevall-Morera D, Langebeck-Jensen K, Hansen S, Ng L, Pocock R.
LIN-32/Atonal Controls Oxygen Sensing Neuron Development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 7294 
[ PubMed ID = 28779171 ] [ RRC reference ]

Zhu Z, Liu J, Yi P, Tian D, Chai Y, Li W, Ou G.
A proneural gene controls C. elegans neuroblast asymmetric division and migration.
FEBS Lett. 2014 588(7) 1136-43 
[ PubMed ID = 24589937 ] [ RRC reference ]

Miller RM, Portman DS.
The Wnt/beta-catenin asymmetry pathway patterns the atonal ortholog lin-32 to diversify cell fate in a Caenorhabditis elegans sensory lineage.
J. Neurosci. 2011 31(37) 13281-91 
[ PubMed ID = 21917811 ] [ RRC reference ]

Li Y, Zhao D, Horie T, Chen G, Bao H, Chen S, Liu W, Horie R, Liang T, Dong B, Feng Q, Tao Q, Liu X.
Conserved gene regulatory module specifies lateral neural borders across bilaterians.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(31) E6352-E6360 
[ PubMed ID = 28716930 ] [ RRC reference ]

Hori S, Oda S, Suehiro Y, Iino Y, Mitani S.
OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses.
PLoS Genet. 2018 14(6) e1007477 
[ PubMed ID = 29939997 ] [ RRC reference ]