Mutants (Isolated)

tm1445

Allele Nametm1445
Sequence NameY75B8A.30
CGC Namepph-4.1
Worm BaseAllele Name tm1445
CGC Name pph-4.1
Sequence Y75B8A.30
Phenotypelethal or sterile
Mutation site280892/280893-AANGGNAA-281900/281901 (1008 bp deletion + 8 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(276460..276589, 279275..279516, 281408..281686, 281762..281887, 281946..282069, 282125..282225))
Map position16.78
BalancerhT2
Map position of balancer
Sequence of primersExtRev:CACGTGTCGACTCACCGACT,IntRev:CCCATCGGACCAGCTAACAA,IntFwd:TGCAAAACCTTCGCCCCGCT,ExtFwd:CGCTTGTCCGTGTGTATTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sen I, Zhou X, Chernobrovkin A, Puerta-Cavanzo N, Kanno T, Salignon J, Stoehr A, Lin XX, Baskaner B, Brandenburg S, Björkegren C, Zubarev RA, Riedel CG.
DAF-16/FOXO requires Protein Phosphatase 4 to initiate transcription of stress resistance and longevity promoting genes.
Nat Commun 2020 11(1) 138 
[ PubMed ID = 31919361 ] [ RRC reference ]