Mutants (Isolated)

tm1443

Allele Nametm1443
Sequence NameT23G7.4
CGC Namesec-5
Worm BaseAllele Name tm1443
CGC Name sec-5
Sequence T23G7.4
Phenotypelethal or sterile. Dr. O. Blacque: could not examine Dyf phenotype. Dr. J. Lee: L1 arrest and Emb.
Mutation site12069/12070-12454/12455 (385 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(8510..8624, 8673..8967, 9638..9761, 9807..10145, 10194..10291, 10355..10649, 10696..11111, 11170..11404, 11457..11652, 11697..12065, 12114..12219, 12269..12335))
Map position1.09
BalancermIn1
Map position of balancer
Sequence of primersExtFwd:CATCTACCCAGACTGCGGAT,IntFwd:CTATTCGTACTTCACCGGGA,ExtRev:CACTCCAACCGTCTCTCCAC,IntRev:ATCGGCTGAGTTTCCGCTGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen S, Li L, Li J, Liu B, Zhu X, Zheng L, Zhang R, Xu T.
SEC-10 and RAB-10 coordinate basolateral recycling of clathrin-independent cargo through endosomal tubules in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(43) 15432-7 
[ PubMed ID = 25301900 ] [ RRC reference ]

Frische EW, Pellis-van Berkel W, van Haaften G, Cuppen E, Plasterk RH, Tijsterman M, Bos JL, Zwartkruis FJ.
RAP-1 and the RAL-1/exocyst pathway coordinate hypodermal cell organization in Caenorhabditis elegans.
EMBO J. 2007 26(24) 5083-92 
[ PubMed ID = 17989692 ] [ RRC reference ]

Zou W, Yadav S, DeVault L, Nung Jan Y, Sherwood DR.
RAB-10-Dependent Membrane Transport Is Required for Dendrite Arborization.
PLoS Genet. 2015 11(9) e1005484 
[ PubMed ID = 26394140 ] [ RRC reference ]